ID: 1103906972

View in Genome Browser
Species Human (GRCh38)
Location 12:124332809-124332831
Sequence CCGGGGGCGATGGGTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103906972_1103906988 24 Left 1103906972 12:124332809-124332831 CCCACCTCACCCATCGCCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 224
Right 1103906988 12:124332856-124332878 TATTTCTTAGAGGTTCAACAGGG 0: 1
1: 0
2: 0
3: 15
4: 192
1103906972_1103906989 25 Left 1103906972 12:124332809-124332831 CCCACCTCACCCATCGCCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 224
Right 1103906989 12:124332857-124332879 ATTTCTTAGAGGTTCAACAGGGG 0: 1
1: 0
2: 0
3: 15
4: 161
1103906972_1103906987 23 Left 1103906972 12:124332809-124332831 CCCACCTCACCCATCGCCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 224
Right 1103906987 12:124332855-124332877 TTATTTCTTAGAGGTTCAACAGG 0: 1
1: 0
2: 0
3: 11
4: 168
1103906972_1103906986 14 Left 1103906972 12:124332809-124332831 CCCACCTCACCCATCGCCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 224
Right 1103906986 12:124332846-124332868 CCTAGCTCATTATTTCTTAGAGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103906972 Original CRISPR CCGGGGGCGATGGGTGAGGT GGG (reversed) Intronic
901644422 1:10708974-10708996 GGGGGGGCCATGGGTGAGGGAGG + Intronic
901659089 1:10787505-10787527 CCGGGGGCGAGGGGGGCGGGCGG + Intronic
901727411 1:11252973-11252995 CTGGGAGCAATGGGTGACGTTGG - Intronic
902378201 1:16040095-16040117 CCTGGGGCCCTGGGTGAGGGTGG + Intergenic
903263563 1:22143506-22143528 CGGGGGGCGGTGGGGGGGGTAGG - Intronic
904276376 1:29387391-29387413 CCTGGGGCCATGGGGGAGCTTGG + Intergenic
904377289 1:30089923-30089945 CCTGGGGCGATGTGTGGGGAGGG + Intergenic
904461851 1:30685375-30685397 TCGGGGGCTGTGGGTGACGTAGG - Intergenic
906210178 1:44008433-44008455 CCGAGAGCCATTGGTGAGGTTGG + Exonic
906318138 1:44800961-44800983 CAGCGGGCGAGGGGTGGGGTGGG + Intronic
907491895 1:54813947-54813969 GCGGGGGCACTGGCTGAGGTTGG - Exonic
915472678 1:156135320-156135342 CCTGGAGAGAGGGGTGAGGTGGG - Intronic
916501453 1:165390869-165390891 CCTAAGGCAATGGGTGAGGTGGG - Intergenic
918248896 1:182684485-182684507 CTAGGGGCGCTGGGTGAAGTGGG - Intronic
921702577 1:218284758-218284780 CCGAGGGAGAAGGGTGCGGTTGG + Intergenic
922238119 1:223736615-223736637 CTGGGGAAGATGGGAGAGGTAGG - Intronic
924632437 1:245753532-245753554 CCTGGGCCTATGGGTGAGCTGGG + Intronic
1062854250 10:771793-771815 CCGGGGCCGATGGGAGGGGTGGG + Intergenic
1064418096 10:15168215-15168237 CCGGCGGGGATGGGCGAGGCTGG + Intronic
1065980274 10:30887833-30887855 CCTGGGGCCATAGGTGAGGGTGG - Intronic
1067070081 10:43124800-43124822 CAGGGTGCGATGGCTGTGGTGGG + Intronic
1070819744 10:79347820-79347842 CCGGGCGCGCTGGGTGACCTTGG + Intronic
1072756214 10:98022876-98022898 CCTGGGGCCAGGGGTGGGGTAGG + Intronic
1072998385 10:100266955-100266977 CCGGGCGCGGTGGCTGAGGCAGG - Intronic
1073096610 10:100983915-100983937 CCGGTGGCGGTGGGGGCGGTGGG - Exonic
1074503154 10:114044095-114044117 CCGGGGGCGGGGGGTGTGGCAGG - Exonic
1076624448 10:131812888-131812910 CCCGTGGCGATGGGAGTGGTGGG + Intergenic
1076676340 10:132149541-132149563 GGGCGGGGGATGGGTGAGGTGGG - Intronic
1076686817 10:132201902-132201924 CTGAGGGCGACGGGTGGGGTTGG - Intronic
1076756996 10:132577685-132577707 CCTGAGGAGATGGATGAGGTGGG + Intronic
1076774900 10:132689867-132689889 CCTGGGGCGATGGGGCAGGGTGG + Intronic
1076783615 10:132738298-132738320 CCGGGTGCGATGTGTGAAGGAGG - Intronic
1076839886 10:133040678-133040700 CGGGGGGCTGTGGGTGAGGTGGG + Intergenic
1076948126 10:133665464-133665486 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076949116 10:133668774-133668796 CCGGGGGCGGGGGGTGGGGGTGG - Intronic
1076950100 10:133672073-133672095 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076951084 10:133675372-133675394 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076952074 10:133678682-133678704 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076953063 10:133681992-133682014 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076954047 10:133685291-133685313 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076955031 10:133741643-133741665 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076956020 10:133744953-133744975 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076957010 10:133748263-133748285 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076957997 10:133751572-133751594 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076958982 10:133754871-133754893 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076959971 10:133758181-133758203 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076960955 10:133761480-133761502 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1077230207 11:1455312-1455334 CTGGGGGCGGTGGGGGAGGCGGG - Intronic
1077293558 11:1813001-1813023 GCAGGCGCGATGGGTGAGGCGGG - Intergenic
1083703313 11:64495621-64495643 CCTGGGGGGATGGGTGGGGGGGG - Intergenic
1083764734 11:64836377-64836399 CTGGGTGAGGTGGGTGAGGTGGG - Intronic
1083812859 11:65115407-65115429 TCTAGGGCCATGGGTGAGGTGGG + Intronic
1084185533 11:67468983-67469005 CCGGGGGCAGGGGGTTAGGTGGG + Intronic
1084949554 11:72657217-72657239 CCCGGGGAGCTGAGTGAGGTGGG - Intronic
1084985595 11:72868350-72868372 CAGAGGGCGATGGGTGGGGAAGG + Intronic
1089171711 11:116516278-116516300 CCTGGGCCCATGGGTGATGTAGG + Intergenic
1089346816 11:117796388-117796410 CCGGGGCAGAGGGGTGGGGTAGG + Intronic
1089804169 11:121068246-121068268 CAGGGGGCTAGGGGTGAGGGAGG - Intronic
1090269807 11:125378281-125378303 CCGGTGGGGTGGGGTGAGGTGGG - Intronic
1091813959 12:3422017-3422039 CAGGGGGCAGTGGGTGGGGTGGG + Intronic
1092041576 12:5389674-5389696 AAGGGTGAGATGGGTGAGGTGGG + Intergenic
1092233681 12:6792280-6792302 CTGGGGGCCAGGGGTGAGGGCGG + Intronic
1092830752 12:12442095-12442117 CTGGGGGCGAGGGATGAGGCTGG + Intronic
1095459810 12:42431359-42431381 TGGGGGGTGGTGGGTGAGGTGGG - Intronic
1095462036 12:42453787-42453809 CCGGGCACGGTGGCTGAGGTGGG - Intronic
1096109240 12:49019360-49019382 ACGGGGGCGGGGGGTGGGGTGGG + Exonic
1096134518 12:49188527-49188549 GCGGGGGCGTTGGGCGAGCTGGG - Intronic
1096849457 12:54426420-54426442 GAGGGGGAAATGGGTGAGGTTGG + Intergenic
1097905476 12:64914874-64914896 CCAGGGGAGAGGGGTGAGGTAGG + Intergenic
1101132405 12:101702936-101702958 CCGGGGACTAAGGGTGAGGCAGG - Intronic
1103074268 12:117969309-117969331 CCGGGGGCGGCGGGGGAGGCCGG + Intergenic
1103906972 12:124332809-124332831 CCGGGGGCGATGGGTGAGGTGGG - Intronic
1104311534 12:127657845-127657867 GCGGGGGCGGTGGGGGATGTGGG - Intergenic
1104929065 12:132328887-132328909 CCGGGCGCGATGGGTCAGGCCGG - Intronic
1105250972 13:18698160-18698182 GCGAGGGCAATGGGTGGGGTAGG - Intergenic
1107058398 13:36130909-36130931 CCGGGGGCGTTGCGTGCGGGCGG - Intronic
1112370354 13:98788187-98788209 CCGGGGGTGGGGGCTGAGGTTGG - Intergenic
1112752468 13:102596926-102596948 GCGGGGGCGAGGGGCGGGGTCGG - Intergenic
1113491616 13:110696909-110696931 ATGGGGGCGATGGGGAAGGTGGG - Intronic
1114514073 14:23286122-23286144 GCGGGGCGGATGGGTGGGGTGGG + Intronic
1115465614 14:33711359-33711381 CCAGGGGAGATGGCTGAAGTTGG + Intronic
1116975820 14:51114561-51114583 CCTGGGGCGGGGGGTGGGGTGGG + Intergenic
1118682917 14:68261916-68261938 CCGGGGACGCTGGGTCAGGCAGG + Intronic
1118782483 14:69017932-69017954 CTGTGGGCGGTGGGTGGGGTGGG - Intergenic
1119421049 14:74508261-74508283 GTGGGGGTGAGGGGTGAGGTGGG + Intronic
1119777764 14:77259104-77259126 AGGGGGGCAATGGGTGAGGCAGG - Exonic
1120881462 14:89417511-89417533 CCGTGGGCGGTGGGGCAGGTGGG + Intronic
1121218708 14:92268708-92268730 CCGGGCGCGGTGGCTGAGGCAGG - Intergenic
1122194366 14:100074001-100074023 CCGGGGGCGGTGGGGGCGGGGGG + Intronic
1122574221 14:102731672-102731694 CCCCGGGCGATGGCTGAGGCTGG + Intergenic
1122685414 14:103502489-103502511 CCAGGGTGGATGGGTGGGGTGGG + Intronic
1122940398 14:104978535-104978557 CCGGGGGCGCGGGGTGGGGCGGG - Intergenic
1124426792 15:29570052-29570074 CCGGGGGCGGTGGGGGTGGGGGG - Intronic
1127014240 15:54665525-54665547 CCGGGGGCGTTAGGTGGGGGTGG + Intergenic
1128030620 15:64476793-64476815 CCTGGAGTGATGGGTGAGGTAGG + Intronic
1128785545 15:70394324-70394346 CAGGGAGCGATGTGGGAGGTGGG - Intergenic
1129115878 15:73365128-73365150 CGGGGTGCGGTGGGTTAGGTGGG + Intronic
1129206267 15:74038699-74038721 CTGGGGAGGATGGGTTAGGTGGG - Intronic
1129770652 15:78201343-78201365 CTGGGGGGCAAGGGTGAGGTGGG - Intronic
1132600483 16:770626-770648 CCTGGGGGGACGGGTGAGGGGGG + Exonic
1132626664 16:894641-894663 TCGGAGGCGATGGCTGTGGTGGG + Intronic
1133219943 16:4315728-4315750 CCGGGAGGGAGGGGTGAGGGAGG - Intronic
1135152520 16:20021432-20021454 CTGGGGGAGATGGGTAGGGTGGG + Intergenic
1136487963 16:30585397-30585419 CTGGGCGCGCTGGGTGAGGCCGG - Exonic
1138455410 16:57117883-57117905 GCGGGGAGGAGGGGTGAGGTCGG - Intronic
1139511791 16:67431970-67431992 CAGTGGGGGATGGGTGGGGTGGG - Intronic
1139651359 16:68363767-68363789 CCGTGGGCCATCGGTGAGCTGGG - Exonic
1141605630 16:85151889-85151911 GCGGGGGCGATTGCTGAGGGAGG - Intergenic
1141674070 16:85508421-85508443 CCAGGGGCGAGAGGTGAGTTGGG + Intergenic
1141802409 16:86319791-86319813 CCAGGGGCCATGGGGAAGGTGGG + Intergenic
1142419601 16:89962153-89962175 GCGGGGGCGCTGTGTCAGGTGGG + Intronic
1143165676 17:4896200-4896222 CAGAGGGCGGTGGGGGAGGTCGG - Exonic
1144949536 17:18986567-18986589 CCGGAGGCAATGGGGCAGGTGGG - Intronic
1146077431 17:29744193-29744215 CCGGGGGTGAGGGGCCAGGTGGG + Intronic
1146297615 17:31661936-31661958 ACCAGGGCAATGGGTGAGGTGGG + Intergenic
1147883732 17:43670459-43670481 CGGGAGGGGAAGGGTGAGGTGGG - Intergenic
1148080988 17:44967741-44967763 CCGGGGGAGAAGGGTGAGCCAGG - Exonic
1148130850 17:45261963-45261985 CCGGGGGCGAGGGTTGGGGCAGG - Intronic
1148684892 17:49495728-49495750 CAGGGGGCGGTGGGGGAGCTGGG + Intronic
1152297780 17:79478312-79478334 CCGGGGTGGATGGATGAGTTTGG + Intronic
1152352066 17:79789780-79789802 CCGGGAGCGATGGGTGCGGAGGG + Intergenic
1152623468 17:81377711-81377733 CCGGGGGCGCTGGGGGAGTCAGG + Intergenic
1152965717 18:112055-112077 CCGGGGGCGGGGGGTGGGGGTGG + Intergenic
1154437878 18:14360754-14360776 GCGAGGGCAATGGGTGGGGTAGG + Intergenic
1154451486 18:14479281-14479303 CCGTGGGCGGCGGCTGAGGTAGG + Intergenic
1157158650 18:45291819-45291841 CCGGGGGCGGTTGGGGGGGTGGG + Intronic
1157461048 18:47894385-47894407 CTGAGGGTGACGGGTGAGGTTGG - Intronic
1157681675 18:49612624-49612646 GCGGAGGCAATGGGTGACGTTGG - Intergenic
1159003238 18:62991509-62991531 CCTGGGGAGATGGGTAAGGGTGG + Intergenic
1160573135 18:79832072-79832094 CAGGGGGCGGTGGGTGAGTGTGG - Intergenic
1160789865 19:918395-918417 CCAGGGGCGCTGGGGGAGGGGGG + Intronic
1160981474 19:1818436-1818458 CCGGGGGCCATGGGTGGGAAGGG + Intronic
1161764606 19:6199769-6199791 CGGGGGGAGATGGGGGAGGAAGG - Intergenic
1161957712 19:7505889-7505911 CCGGGGGGGAGGGAGGAGGTGGG - Intronic
1162713002 19:12610305-12610327 GTGGGGGCGGTGGGGGAGGTCGG - Intronic
1162914899 19:13869435-13869457 CCGTGGGCGGTGGGTGGGCTAGG - Intronic
1166394370 19:42427926-42427948 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1167289044 19:48614672-48614694 ATGGGGGGGATGGGTGAGGGTGG - Intronic
1167337656 19:48896556-48896578 GCTGGGGAGATGGGAGAGGTGGG + Exonic
1167411832 19:49348789-49348811 CTGGGGGCGATGGGGTAGGTGGG + Exonic
1167461105 19:49625211-49625233 CCCAGGGCGATGGGTGCTGTGGG - Intronic
925512332 2:4641738-4641760 CCGTGGGAGATGGCTGAGGTGGG - Intergenic
926123425 2:10256958-10256980 CAGGGGGCGCTGCGTGAGGGAGG - Intergenic
926394683 2:12428641-12428663 CGGGGGGCGAGGGGGAAGGTTGG - Intergenic
927135680 2:20094459-20094481 CCTTGGGCGGTGGGTGGGGTTGG + Intergenic
932492921 2:72132980-72133002 CCGGGGGCGATGGGGGAGCAGGG - Intronic
932580923 2:72992252-72992274 CCAGGAGCTATGGGTGGGGTGGG + Intronic
935941068 2:108239916-108239938 CCTGGGAGGATGGGTGGGGTGGG - Intergenic
937314543 2:120922700-120922722 CTGGCGGTGATGTGTGAGGTTGG - Intronic
937363080 2:121242542-121242564 CCTGGGGCCCTGGGTGAGGTGGG - Intronic
945094061 2:206202682-206202704 CGGGTGGGGATGGGGGAGGTGGG + Intronic
946068936 2:217014648-217014670 ACGGGGGCCATGAGGGAGGTGGG + Intergenic
948421654 2:237863960-237863982 CCTGGGGTGGTGGGTGGGGTGGG - Intronic
948805838 2:240453237-240453259 GCTGGGGCGACGGGTGGGGTGGG - Intronic
948822623 2:240557738-240557760 CTGGGGGCGTGGGGTTAGGTGGG - Intronic
948993283 2:241565185-241565207 CCTGGGGCGCTGGGTGGGGTGGG - Intronic
948994367 2:241571072-241571094 CTGGGGGAGATGGGTGAGGCAGG + Intronic
1168839296 20:898934-898956 CCAGGGGCTCTGGGTGTGGTTGG - Intronic
1172952470 20:38730796-38730818 CTGGGGCCGAGGGGTGGGGTGGG + Intergenic
1175814084 20:61874540-61874562 CCCTGGGCGGTGGGTGAGGTCGG + Intronic
1175858187 20:62133917-62133939 CCCGAGGCGCTGGGTGGGGTTGG - Intronic
1178677400 21:34642790-34642812 CCATGGGTGATGGGTGTGGTTGG + Intergenic
1179933985 21:44591059-44591081 CGGGGGGCACAGGGTGAGGTGGG - Intronic
1180056847 21:45363399-45363421 TCCCGGACGATGGGTGAGGTTGG - Intergenic
1180058057 21:45369247-45369269 TCCCGGACGATGGGTGAGGTTGG + Intergenic
1181171541 22:21012813-21012835 CTGGGGGCTCTGGGAGAGGTGGG - Intronic
1183187497 22:36300382-36300404 CCCAGGGCCATGGCTGAGGTGGG + Intronic
1183401748 22:37608996-37609018 CCGGGGGCGGGGCGTGAGGAGGG - Intronic
1183737869 22:39653861-39653883 AAGGAGGGGATGGGTGAGGTAGG + Intronic
1184139804 22:42571937-42571959 CGGGGGGCGGGGGGTGGGGTGGG + Intronic
1184669724 22:46006410-46006432 CCTGGGGCCATGGGTGTCGTAGG - Intergenic
1185329357 22:50245295-50245317 CGGGGCGCGATGGGTGGGGCGGG + Exonic
950153182 3:10703996-10704018 CAGGGAGGGATGGGTGAGGCAGG - Intronic
950627546 3:14259203-14259225 CGGGGAGAGATGGGTGAGGGTGG - Intergenic
953847879 3:46443266-46443288 TCTGGGGCGGTGGGTGTGGTGGG + Intronic
954105790 3:48409286-48409308 CACGGGGGGATGGGTGAGGGTGG - Intronic
956615665 3:71169597-71169619 CGGGGGGCGGTGGGGGAGGAAGG - Intronic
961164126 3:124751864-124751886 GGGGGGGGGAAGGGTGAGGTGGG - Intergenic
962325953 3:134432366-134432388 GCGAGGACGATGGCTGAGGTGGG + Intergenic
963253121 3:143120202-143120224 CTGGGGGCGATGGCTGGGGGCGG - Exonic
971421943 4:26481723-26481745 CCAGGGGCGAGGGGAGAGGTGGG - Exonic
973690867 4:53429941-53429963 CTGGGGGCCACGGGTGAGGTAGG - Intronic
980329184 4:131388710-131388732 CCTGGGGAGATGTGTGTGGTGGG - Intergenic
985057925 4:186051249-186051271 CCGGGGGTGGTGGAGGAGGTGGG + Intergenic
985758926 5:1734784-1734806 CCGGCAGGGATGAGTGAGGTGGG + Intergenic
985770512 5:1807274-1807296 CCGGGGGCGGGGGGTGAATTTGG + Intronic
985777315 5:1851571-1851593 ACGGAGGAGATGGGGGAGGTGGG - Intergenic
994355765 5:98792564-98792586 GCGGGGGGGATGGTGGAGGTCGG - Intronic
995764587 5:115602042-115602064 CCGGGGGCGCGGGGTGGGCTGGG - Intronic
997584038 5:135034270-135034292 CCAGGGGTGCTGGGTGGGGTGGG + Exonic
1001797883 5:174517475-174517497 CGGGGGGAGATTGGGGAGGTGGG - Intergenic
1002061415 5:176628049-176628071 CCAGGAGCCATGGGTGTGGTGGG + Intronic
1002636535 5:180611581-180611603 GCGGGGGCGAGGGCTGAGGGCGG - Intronic
1003911452 6:10747631-10747653 CCGGGGGCGGGGAGTGAGGCGGG - Intergenic
1006300316 6:33190601-33190623 CTGGGTGGGGTGGGTGAGGTGGG + Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1012624988 6:101393816-101393838 CCTGGAGCTAGGGGTGAGGTGGG - Intergenic
1018001238 6:159580501-159580523 CAGAGGGCGATGGGTGAGGAGGG + Intergenic
1019291796 7:254127-254149 CCGGGTGCGTGGGGTGTGGTGGG + Intronic
1020044609 7:5031757-5031779 CCTGGGGAGATGGAGGAGGTGGG - Intronic
1023247596 7:38221949-38221971 CCGGGAGCGATGGGAAGGGTAGG - Intronic
1027005070 7:74685787-74685809 CCGGGGGCGATGGCTCACGCCGG + Intronic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1029628276 7:101734086-101734108 CGGGGGGCGGGGGGTGAGGGTGG - Intergenic
1034192715 7:149224055-149224077 GCGGGGGCGATGGGGGCGGTGGG + Exonic
1035057689 7:156046822-156046844 CCTGGGGCTGTGGGTGAGGGCGG + Intergenic
1035580573 8:737364-737386 CCGGGGGCGACGGGTGTGACCGG + Intronic
1037967644 8:23146423-23146445 TCGGGGGCCAGGGGTGAGGCCGG + Intronic
1038150740 8:24941116-24941138 ATGGGGGCGAGGGGTGGGGTAGG - Intergenic
1039794017 8:40897127-40897149 CCGGGGTGGGTGGGTGAGGATGG - Intronic
1039831729 8:41220895-41220917 TAGGGGGAAATGGGTGAGGTTGG - Intergenic
1040584509 8:48726776-48726798 ACTGGGTTGATGGGTGAGGTGGG - Intronic
1042252993 8:66775141-66775163 CCGGTGGTGATTGGTGAGGGCGG + Intronic
1042351164 8:67779076-67779098 CTGGTGGCGGTGGGTGAGGGAGG + Intergenic
1043502602 8:80873180-80873202 CCGGTGGGGACGGGTGAGGCAGG - Intronic
1043846255 8:85167408-85167430 CCGGGGCCTATGGGGGAGGAGGG + Intergenic
1048868638 8:138779516-138779538 CCGGGGCTGCCGGGTGAGGTCGG - Exonic
1049769643 8:144373962-144373984 CCGTGGGCGGTGGGCGAGGCTGG - Intronic
1050437943 9:5629222-5629244 CCGGTGGCGGTGTGGGAGGTGGG + Exonic
1050472534 9:6008023-6008045 CCGGGGGGGAGGGGAGAGGAGGG - Intergenic
1056963094 9:91143821-91143843 CCTGGGGCCGTGGGTGTGGTGGG - Intergenic
1057881581 9:98796478-98796500 GCGGCGGCGATGGGCGAGGGCGG - Exonic
1059769210 9:117411994-117412016 GGGGGGGGGAGGGGTGAGGTGGG - Intronic
1060175012 9:121491332-121491354 CCTAGGGCGAAGGGTGATGTTGG - Intergenic
1060283488 9:122228874-122228896 CCGGGGGCGGGGGCTGAGGCCGG - Intronic
1061065561 9:128275694-128275716 CCGGGGGCGACTGGCGAGGGCGG + Intronic
1061170113 9:128947654-128947676 CCGGGGGCGAGCGGTCACGTGGG + Intronic
1061301219 9:129705966-129705988 CAGGGGGTGAGGAGTGAGGTGGG - Intronic
1061972099 9:134050402-134050424 ACGGGGACGATGGGTGTGGCAGG + Exonic
1062203435 9:135321379-135321401 CTGGGTGGGCTGGGTGAGGTGGG - Intergenic
1062474093 9:136719042-136719064 CCTGGGGCCATGGGTGGGGAAGG + Intronic
1062538360 9:137030677-137030699 CCGGGGGAGGTGGGTGTGGGTGG - Exonic
1189283032 X:39832584-39832606 CCAGGTGCCATGGGTGACGTGGG - Intergenic
1191211805 X:57892393-57892415 CAGGGGGCGGTGGGTGGGGGGGG + Intergenic
1192263564 X:69523693-69523715 CAGCGGGGGATGGGTGGGGTGGG - Intronic
1193085823 X:77447411-77447433 CCGGGGGAGATGGATGCGGAGGG + Intergenic
1195625286 X:107000138-107000160 CCGGGCGGGAGGGGTGAGGCCGG + Exonic
1195732442 X:107980791-107980813 CAGGGGGAGAGGGGAGAGGTGGG - Intergenic
1198116687 X:133551130-133551152 CCAAGGGCGAAGGGTGGGGTGGG - Intronic
1198134968 X:133739769-133739791 CATGGGGCAAGGGGTGAGGTGGG + Intronic
1199544154 X:148989721-148989743 CCAGTGGAGATGGGTGAAGTTGG + Intronic
1200115642 X:153768624-153768646 CTGGGGTGGCTGGGTGAGGTGGG + Intronic