ID: 1103909586

View in Genome Browser
Species Human (GRCh38)
Location 12:124344907-124344929
Sequence GGAGCCAGTGGTGGACGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103909579_1103909586 19 Left 1103909579 12:124344865-124344887 CCGGCCGGGGCTGCCGATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 169
1103909582_1103909586 6 Left 1103909582 12:124344878-124344900 CCGATGAGGGAGCGTACGTCGTG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 169
1103909581_1103909586 15 Left 1103909581 12:124344869-124344891 CCGGGGCTGCCGATGAGGGAGCG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103909586 Original CRISPR GGAGCCAGTGGTGGACGCGC CGG Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900191972 1:1355811-1355833 GGAGTCAGTGGGGGAGGGGCAGG + Intronic
900326075 1:2109306-2109328 GGAGGCACTGCCGGACGCGCAGG + Intronic
900762519 1:4482640-4482662 GGAGCACGTGGTGGCCACGCAGG - Intergenic
901109622 1:6784892-6784914 GGTGGCTGTGGGGGACGCGCCGG - Intergenic
902031080 1:13422659-13422681 GGAGCCAGCAGGGGACGGGCTGG + Intergenic
903144670 1:21363311-21363333 GGAGGCCGTGGTGGAGGGGCTGG - Intergenic
904778245 1:32925041-32925063 CGAGCCGGGTGTGGACGCGCTGG + Intergenic
904900919 1:33856385-33856407 GGAGCCAGTGGAGGCCAGGCTGG - Intronic
905126385 1:35718725-35718747 GGAGCCAGAGCCAGACGCGCCGG - Exonic
905340396 1:37273914-37273936 GGAGCTAGTGGTGGGGGCGGGGG - Intergenic
907320113 1:53596687-53596709 GGAGCCAGAGATGGAGGGGCTGG - Intronic
912675515 1:111676718-111676740 GGGGCCAGTGGTGGTGGCACAGG - Intronic
915969469 1:160343537-160343559 GGAGACAGTGGCGGTCGCGGCGG - Intronic
917214024 1:172659373-172659395 GGAGGCAGTGGTGGCGGCGGCGG - Exonic
920002175 1:202807774-202807796 GGAGCCGGGGGTGGTCGCGGGGG - Intronic
922415046 1:225413842-225413864 GGAGCCAGTGGGGGAGTGGCTGG - Intronic
1062867778 10:871395-871417 GGAGCGTGTGGTGGACACGCAGG - Intronic
1064965496 10:21011804-21011826 GGGGCCAGGGGTGGATGTGCAGG - Intronic
1065019886 10:21495317-21495339 GGGGGCAGTGGCGGACCCGCAGG - Exonic
1066064081 10:31749983-31750005 GGAGCTTGTGGTGGAGGGGCTGG - Intergenic
1067015226 10:42753307-42753329 GGAGGCCGCGCTGGACGCGCCGG - Intergenic
1075210044 10:120483256-120483278 GAAGCCAGTGGTGGATCAGCAGG - Intronic
1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG + Intronic
1076688302 10:132208066-132208088 GGAGCCTGTGGAGGACGAGGCGG - Exonic
1076778203 10:132709681-132709703 GGAGCCTGTGGAGGACACGCAGG + Intronic
1078390324 11:10931280-10931302 GGAGCCCGTGGTGGTGGTGCTGG + Intergenic
1079519884 11:21314005-21314027 GGAGCAAGTGGGGGTCGCGGGGG - Intronic
1082789232 11:57335760-57335782 GGCGCGAGAGGTGGGCGCGCTGG + Exonic
1083679588 11:64344974-64344996 GGAGGCGCTGGTGGAGGCGCTGG + Exonic
1086584426 11:88434481-88434503 GGAGCCAGTGGTGCAGCTGCAGG - Intergenic
1089671009 11:120056991-120057013 GGAGCCAGGGGTGGCGGTGCTGG - Intergenic
1092242381 12:6843254-6843276 GGATGCAGTGGTGGAGGCTCAGG - Intronic
1092894877 12:13001427-13001449 GGAGCCTGTGGCGGCCGCGGGGG + Intergenic
1096684381 12:53278061-53278083 AAAGCCAGTGATGGAAGCGCAGG + Intronic
1100260500 12:92928813-92928835 GGCGCCAGGCCTGGACGCGCGGG + Intronic
1100715250 12:97299023-97299045 GAAGCCAGTGGTGGATCAGCCGG + Intergenic
1103363680 12:120368385-120368407 GGCGGCAGTGGAGAACGCGCGGG - Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1103954301 12:124567724-124567746 GGAGCCAGAGGGGGCCGGGCCGG - Intergenic
1104592029 12:130092451-130092473 GGAGCCAGGGGTGGCCCAGCAGG + Intergenic
1105012737 12:132766523-132766545 GCAGCCAGTGGTGGAGCCGGGGG + Intergenic
1105540039 13:21308371-21308393 GGAGCCAGGGGTGGGTGGGCTGG + Intergenic
1106162266 13:27212179-27212201 GGAGCCAGGGCTGCAGGCGCAGG + Intergenic
1114364444 14:22012008-22012030 GGCGCCAGTGGTGGGGGCCCAGG + Intergenic
1118333403 14:64831736-64831758 TGCCCCAGTGGTGGACGCACAGG - Intronic
1119307377 14:73618467-73618489 GGAGCCAGTGATGGAAGAGAAGG + Intronic
1124349302 15:28943730-28943752 GGAGCCAGGGCTGGAGGAGCCGG - Intronic
1125453333 15:39831796-39831818 GGAGCCAGTGGAGGATACGGAGG - Intronic
1125722510 15:41852066-41852088 GGAGCCAGTGCTGGGAGCCCGGG - Intronic
1127753489 15:62068156-62068178 GCAGCCCGTCGGGGACGCGCAGG - Exonic
1127763568 15:62164435-62164457 GCAGCCCGTCGGGGACGCGCAGG + Exonic
1128199454 15:65792214-65792236 GGAGGCAGTGGCGGCCGCGAGGG - Intronic
1128724386 15:69977066-69977088 AGAGCCAGTGTTGGAGGCACTGG + Intergenic
1130842098 15:87710243-87710265 GCAGCCAGTCGTGGAGGCCCTGG - Intergenic
1132671860 16:1105363-1105385 GGAGCCAGCGGTGGCCAGGCTGG + Intergenic
1132870632 16:2114286-2114308 GGAGCACGTGGTGGACGTGGTGG - Exonic
1136364962 16:29805777-29805799 GGCGCAGGTGGTGGGCGCGCGGG - Intergenic
1136534770 16:30893217-30893239 GGTGCCAGTGGTGGATCCCCAGG - Exonic
1136747575 16:32605300-32605322 GGAGACAGTGGTTGAGGCGATGG - Intergenic
1138889844 16:61128838-61128860 GGAGCCGGTGGGGGAGGGGCGGG + Intergenic
1141594143 16:85087215-85087237 GGAGCCAGTGCTGTGCCCGCTGG + Intronic
1142076150 16:88119361-88119383 GCAGCCTGTGGTGCACGTGCGGG + Intergenic
1142192640 16:88725025-88725047 GGAGGCAGTGGTGGCGGCCCTGG - Exonic
1203049710 16_KI270728v1_random:864505-864527 GGAGACAGTGGTTGAGGCGATGG - Intergenic
1143015796 17:3890547-3890569 GGAGACAGAGGAGGACGAGCAGG - Intronic
1143323161 17:6080943-6080965 GGAGCCAGCGGGGGCCGGGCCGG - Exonic
1145255073 17:21317962-21317984 GGAGGCAGGGGTGGGCGCCCGGG - Intergenic
1146453200 17:32990959-32990981 AGAGACAGTGGTGGATGTGCAGG - Intronic
1147322254 17:39653402-39653424 GGAGCCAGTGGTGGCCCTGGTGG + Intronic
1148551076 17:48551121-48551143 GGAGGCAGTGGTGGCAGCGGGGG - Exonic
1150618338 17:66789449-66789471 GGAGGCAGTGGTGGAAGAGGGGG - Intronic
1152231748 17:79117391-79117413 GGAGCGTGGGGTGGAGGCGCAGG - Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1152894604 17:82903706-82903728 GGAGCCCGTGATGGTCCCGCCGG + Intronic
1158669739 18:59464082-59464104 GGAGACAGTGGGGGAGGGGCAGG - Intronic
1160072229 18:75639036-75639058 AGAGACAGTGCTGGAAGCGCCGG + Intergenic
1161306638 19:3572681-3572703 GGAGCGAGTGGCGGACTTGCCGG - Intronic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1162100413 19:8335424-8335446 GGAGCGTGTGCTCGACGCGCGGG + Exonic
1162250112 19:9435454-9435476 GGAGCCAGCGGTGGAAGGGGTGG - Intronic
1162573914 19:11487622-11487644 GGAGACAGTGGTGTGCGTGCCGG - Exonic
1163394132 19:17049200-17049222 GGACCCAGTGGTGGACGTCCTGG + Intergenic
1165248469 19:34512130-34512152 AGAGACAGTGGTGGAGGTGCTGG + Exonic
1166690901 19:44820787-44820809 GGAGCCAGGGGTGGCAGCGGGGG + Exonic
1166808173 19:45499231-45499253 GGAGCCAGAGGTGGCCGCACTGG + Exonic
1167426572 19:49432711-49432733 GGAGCCGGTGGTGCACGGACCGG - Intronic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
927786940 2:25981070-25981092 GGAGGCAGTGGTGGTGGTGCTGG - Exonic
933024163 2:77233868-77233890 GGAGGCAGGGGTGGACGCGGAGG - Intronic
935681914 2:105645467-105645489 GGAGACACTGGCGGACGTGCTGG - Intergenic
938614859 2:132987161-132987183 AGAGCCAGTGGAGGACACACAGG - Intronic
944863829 2:203841037-203841059 AGAGGCAGTGGTGGAGGGGCAGG + Intergenic
947611914 2:231530095-231530117 GGAACCAGTTGGGAACGCGCAGG + Intronic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948252608 2:236542597-236542619 GTGGCCAGTGGTGGGCGCCCTGG + Intergenic
948988992 2:241542241-241542263 GGAGACAGTGGTGGGCACACTGG - Intergenic
949000400 2:241610051-241610073 GGGGCCGGTGGTGGCCGTGCCGG - Intronic
1172112736 20:32556830-32556852 GGAGCCAGAGCTGGACGTGCCGG + Intronic
1175326096 20:58129503-58129525 GGAGCCTGTGGTTGACTGGCAGG + Intergenic
1176548581 21:8212192-8212214 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1176556475 21:8256400-8256422 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1176567512 21:8395227-8395249 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1176575414 21:8439442-8439464 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1179828557 21:43981945-43981967 GGTGACAGAGGTGGACGAGCAGG - Intronic
1180094398 21:45549316-45549338 GGTGCCTGTGGTGGAGGCTCGGG + Intergenic
1181442435 22:22943601-22943623 GGACCCAGTGGTGGCCTCGGGGG + Intergenic
1181901890 22:26162978-26163000 GGAGTTAGTGGTGGAGGCTCTGG + Intergenic
1183306639 22:37086376-37086398 GGAGCCCGTGGTGGAGGTTCTGG - Exonic
1183710629 22:39501466-39501488 GGAGCCAGCGGTGGCCCCGGTGG + Intronic
1183953754 22:41367347-41367369 CGAGCCGGGGGTGGACGGGCGGG + Intronic
1184556790 22:45237568-45237590 GGAGCCTCAGGTGGAGGCGCTGG - Intronic
1184857445 22:47154119-47154141 GGAGACAGTGCTGGAGGCCCAGG - Intronic
1185112102 22:48905815-48905837 GCAGCCACTGGTGGATGCGCAGG + Intergenic
1185402201 22:50625081-50625103 GGAGCCTGTGGGGGAGGCTCAGG - Exonic
1203253465 22_KI270733v1_random:128497-128519 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1203261519 22_KI270733v1_random:173575-173597 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
950074974 3:10180775-10180797 GGATGCTGTGGTGGACGTGCAGG + Intronic
950312070 3:11967456-11967478 GGATCCAATGGTGGAAGCCCTGG - Intergenic
950497168 3:13340705-13340727 GGAGCCAGGGGTGGCCCCACAGG + Intronic
953793576 3:45966555-45966577 GGAGCGAGTGGAGGAGGCACTGG - Exonic
953981629 3:47416175-47416197 GGAGCCAGTGTGGGACAGGCAGG + Intronic
954364220 3:50137785-50137807 GGAGCCAGGGCTGGAGGAGCAGG - Intergenic
954396728 3:50297028-50297050 GGAGACAGTGGTGGTGGCCCGGG - Exonic
961458066 3:127033981-127034003 GGAGCAGGTGGTGGACACGATGG + Exonic
961660542 3:128466511-128466533 GGACACAGTGGTGGACATGCTGG + Exonic
963988962 3:151630973-151630995 TGAGCCAGTGGTGGAGGTGGGGG + Intergenic
968178129 3:196568839-196568861 GGCGGGAGTGGTGGAGGCGCCGG + Exonic
969176653 4:5403894-5403916 GGAGCCAGTGGTGGATGTCTTGG + Intronic
969314358 4:6372547-6372569 GGTGCCAGAGGTTGATGCGCAGG + Exonic
970531348 4:16988639-16988661 GGAGACAGTGGAGGAAGAGCAGG + Intergenic
982358317 4:154492088-154492110 GGGGCGGGTGGGGGACGCGCAGG + Intergenic
983058584 4:163128946-163128968 GGAGGCAGTGGTGGAGGGGGAGG + Exonic
985126361 4:186698688-186698710 GGAGCCAGTGAGGGAAGCACGGG + Intronic
985551069 5:533879-533901 GGAGACAGTGCTGGATGCCCAGG + Intergenic
988707582 5:33740896-33740918 GGAGACAGTGGAGCACGAGCTGG - Intronic
992545547 5:77811115-77811137 GGAGCCAGTGGGGGACTATCTGG + Intronic
994692153 5:103032824-103032846 GCAGCCAGTGGTCGATGTGCTGG - Intergenic
1000393647 5:160750370-160750392 GGAGTCAGTGATGGAGGAGCGGG - Intronic
1002164545 5:177336316-177336338 GGAGCCAGAGGTGGCAGGGCTGG + Intronic
1003441637 6:6148250-6148272 GGAGGCAGTGGGGGAAGAGCAGG + Intronic
1004211401 6:13649720-13649742 GTAGCCAGTGGTGGAAGTGGGGG - Intronic
1010058095 6:71588801-71588823 GGAGCAAGTGGTGGTGGCGGCGG + Intergenic
1012398943 6:98828815-98828837 GGAGCAGGTGGTGCACGGGCGGG - Intergenic
1016388748 6:143554045-143554067 GGATCCAGTGGCGGGGGCGCTGG + Intronic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1019343582 7:519508-519530 GGGGCCGGCGGTGGGCGCGCAGG - Intronic
1019350710 7:552708-552730 GGAGCCGGGAGGGGACGCGCTGG + Intronic
1022610607 7:31867682-31867704 GGAGCCAGTGGTGGCAGCAGTGG - Intronic
1023267061 7:38417824-38417846 GGAGCCAGTGGAGGAGGCAGTGG - Exonic
1026376122 7:69752816-69752838 GGAGTCAGTGATGGAGGCTCAGG + Intronic
1026522793 7:71131673-71131695 GGAGCCCGGAGGGGACGCGCAGG - Intergenic
1034965729 7:155389464-155389486 GCAGCCCCAGGTGGACGCGCTGG + Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037914822 8:22766640-22766662 GGAGCCAGTGGAGGGCATGCTGG + Intronic
1038658243 8:29473842-29473864 TGAGCCAGTGGTGAAGGAGCAGG - Intergenic
1039906071 8:41787192-41787214 GGAAACAGTGGTGGAGGGGCTGG + Intronic
1049741715 8:144244228-144244250 GGAGCCAGCGCTGGACGAGCAGG + Exonic
1049748755 8:144273831-144273853 GGAGCCCCTGGAGGAGGCGCTGG - Intronic
1049799080 8:144509501-144509523 GGCCCCGCTGGTGGACGCGCAGG + Exonic
1053409980 9:37909630-37909652 GGATTCAGTGGTGGAGGCCCAGG - Intronic
1053870931 9:42491103-42491125 GCAGACAGTGCTGGACTCGCTGG + Intergenic
1055513835 9:77018523-77018545 CGAGCGAGTGGTGAACGCGATGG + Intergenic
1057022933 9:91714602-91714624 GGAGCCAGGGGTGGGCGGGGAGG + Intronic
1057488368 9:95504523-95504545 GGATCAAGTGGTGGATGAGCCGG + Intronic
1057723901 9:97554847-97554869 GGAGCCACTGGGGGATGTGCAGG + Intronic
1057790087 9:98118981-98119003 GGAGGCAGCGGTGCACGTGCAGG - Exonic
1061326551 9:129868058-129868080 GGAGCCGGTGGTGGCCACGGTGG + Exonic
1061561852 9:131409586-131409608 GGAGCCTGTGGGGGCCGGGCTGG + Intronic
1062448281 9:136604832-136604854 GCAGACAGTGGTGGAGGCCCAGG - Intergenic
1203469865 Un_GL000220v1:111644-111666 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1203477686 Un_GL000220v1:155616-155638 GGAGTCCGCGGTGGAGGCGCGGG - Intergenic
1186445861 X:9628284-9628306 GCATCCAGTGGGGGACGCCCAGG - Intronic
1186610874 X:11137066-11137088 CCAGCCAGTGGTGGAAGTGCTGG + Intergenic
1189490171 X:41465273-41465295 GGAGCCAGTGGTAGAAACTCTGG + Intronic
1190440471 X:50470563-50470585 GGAGCCGGTGGTGGTGGCGGCGG + Exonic
1199445145 X:147912185-147912207 GGAGCTGGTGGTGGAAGTGCGGG + Exonic
1200124680 X:153807694-153807716 GGGGCCAGTGCTGGGCGGGCGGG - Intronic