ID: 1103909986

View in Genome Browser
Species Human (GRCh38)
Location 12:124346770-124346792
Sequence GAGGCGTGCCCTCCCGCTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103909976_1103909986 10 Left 1103909976 12:124346737-124346759 CCTCGGTCAGGTCCCGTGAGGGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 57
1103909984_1103909986 -3 Left 1103909984 12:124346750-124346772 CCGTGAGGGCGGTGGGGGCGGAG 0: 1
1: 0
2: 4
3: 41
4: 459
Right 1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 57
1103909972_1103909986 25 Left 1103909972 12:124346722-124346744 CCTGCGTCTTGTAGGCCTCGGTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 57
1103909983_1103909986 -2 Left 1103909983 12:124346749-124346771 CCCGTGAGGGCGGTGGGGGCGGA 0: 1
1: 0
2: 2
3: 31
4: 333
Right 1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103909986 Original CRISPR GAGGCGTGCCCTCCCGCTTT AGG Exonic
904568829 1:31445421-31445443 GGGGCGGGTCCTCCCACTTTGGG - Intergenic
905979549 1:42211266-42211288 GAGGTGTGCCCTCCAGATTCAGG + Intronic
913650996 1:120913599-120913621 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914170118 1:145215468-145215490 CTGGCGCCCCCTCCCGCTTTTGG + Intergenic
914525235 1:148459431-148459453 CTGGCGCCCCCTCCCGCTTTTGG + Intergenic
914598441 1:149176399-149176421 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914641167 1:149607703-149607725 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914693034 1:150048226-150048248 GAGACGTATCCTCCCACTTTCGG + Intergenic
915801050 1:158794077-158794099 GAGGAGTGCCCTCCAGGTTCAGG - Intergenic
1068171883 10:53404607-53404629 GAGGAGTGCCCTCCAGGTTCAGG + Intergenic
1070248184 10:74751117-74751139 GAGGGGGGCCCCCCAGCTTTCGG + Intergenic
1076978523 11:193108-193130 GAGCCGTGCCCTCCTGCTGGTGG + Exonic
1083290714 11:61688595-61688617 GAGGCGGTCCCTCCCACTCTGGG + Intronic
1099163671 12:79275426-79275448 GAGGTGTGCCCTCCAGGTTCAGG + Intronic
1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG + Exonic
1107986853 13:45783538-45783560 GGGGCGTGGCCTCCCACTTGAGG + Exonic
1136788690 16:32951356-32951378 CAGCCGTGCCCTGCCCCTTTGGG + Intergenic
1136881122 16:33902578-33902600 CAGCCGTGCCCTGCCCCTTTGGG - Intergenic
1140522490 16:75593888-75593910 GTGGCGTGCCATGCCCCTTTTGG - Intergenic
1203090887 16_KI270728v1_random:1212845-1212867 CAGCCGTGCCCTGCCCCTTTGGG + Intergenic
1142465954 17:137599-137621 GAGCCGTGCCCTCCTGCTGGTGG + Exonic
1144504509 17:15818348-15818370 GAGGCCTGCCCTCCTGCTGCTGG + Intergenic
1146164455 17:30576825-30576847 GAGGCCTGCCCTCCTGCTGCTGG + Intergenic
1148222358 17:45871989-45872011 GAGGCCTCCCCTCCCTTTTTAGG - Intergenic
1152789677 17:82272650-82272672 GGGGCTTGCCCTCCCGCTGGGGG - Intronic
1152857869 17:82676399-82676421 GAGGGGTGCCCTCACTCTGTGGG - Intronic
1157723633 18:49945534-49945556 GAGGTATGCCCTCACGCTTTCGG - Intronic
1167469943 19:49670128-49670150 GAGGCGTGGCTTCCCGGTTCAGG - Intronic
929252921 2:39779247-39779269 CAGGCGCGCCCTCGCGCCTTCGG + Exonic
947556738 2:231099779-231099801 GAGGCGAGCCATCCCCATTTCGG - Intronic
1171449126 20:25223961-25223983 GAGGCAGGCCCTCCAGCTGTAGG - Intronic
1174407314 20:50310656-50310678 GAGGCCTGCCCTCCCTCCTGGGG + Intergenic
1176677975 21:9798799-9798821 GAGGCTTTTCTTCCCGCTTTAGG + Intergenic
1184670900 22:46011916-46011938 GAGGCCTGCCCTCCCGGCTCAGG + Intergenic
960834786 3:121894612-121894634 GAGGAATGGCCTCCCTCTTTTGG + Intronic
979832359 4:125317394-125317416 GAGGCGTGCCTTCCCTCACTGGG + Exonic
981923742 4:150116149-150116171 GAGGAGTGCCCTCCAGGTTCAGG - Intronic
983533409 4:168833040-168833062 GAGCCCTGCGCTCCAGCTTTGGG - Intronic
985397549 4:189559992-189560014 GAGGCTTTTCTTCCCGCTTTAGG - Intergenic
997704088 5:135930561-135930583 GAGGCGTGCGCTCGCGCCCTGGG + Intronic
999365351 5:151020360-151020382 GAGGCGGTCCCTTCCTCTTTTGG - Intergenic
1001093109 5:168756179-168756201 GAGCAGTGCCCTCCTGCTCTGGG - Intronic
1006152155 6:31995378-31995400 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1006158457 6:32028116-32028138 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1006393381 6:33771929-33771951 GAGGCGGGCCCGCCCGCCCTGGG + Exonic
1021769620 7:23985258-23985280 GAGGAGTGCCCTCCAGGTTCAGG + Intergenic
1023510277 7:40945405-40945427 GAGGAGTGCCCTCCAGGTTCAGG - Intergenic
1030808564 7:113946367-113946389 GAGGAGTGCCCTCCAGGTTCAGG + Intronic
1044880151 8:96715444-96715466 GAGGAGTGCCCTCCAGGTTCAGG - Intronic
1047384211 8:124394672-124394694 GAGGAGTACCCTCCAGGTTTAGG - Intergenic
1053151368 9:35745400-35745422 GAGGCGTGAGCTACCGCTTCTGG + Intronic
1203663123 Un_KI270754v1:1291-1313 GAGGCTTTTCTTCCCGCTTTAGG + Intergenic
1203663134 Un_KI270754v1:1347-1369 GAGGCTTTTCCTCCCACTTTAGG + Intergenic
1189834540 X:45006244-45006266 GAGGCATGCCCTGCCCCTTGTGG - Intronic
1190586249 X:51945675-51945697 CAGGCTTGCTCTCCCACTTTAGG + Intergenic
1194614883 X:96087971-96087993 GAGGAGTGCCCTCCTGATTCAGG + Intergenic
1196675810 X:118419168-118419190 GATTCGTGCCCTCCCCCTTCTGG + Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic