ID: 1103912412

View in Genome Browser
Species Human (GRCh38)
Location 12:124359766-124359788
Sequence TTCCTCCAGTTGGGCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103912405_1103912412 -6 Left 1103912405 12:124359749-124359771 CCTGGAGAGACAACCTGTTCCTC 0: 1
1: 0
2: 2
3: 21
4: 160
Right 1103912412 12:124359766-124359788 TTCCTCCAGTTGGGCCCAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 187
1103912402_1103912412 18 Left 1103912402 12:124359725-124359747 CCAGGCTGGGCGGGCGGCCGAGA 0: 1
1: 0
2: 1
3: 23
4: 290
Right 1103912412 12:124359766-124359788 TTCCTCCAGTTGGGCCCAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 187
1103912404_1103912412 1 Left 1103912404 12:124359742-124359764 CCGAGAGCCTGGAGAGACAACCT 0: 1
1: 0
2: 2
3: 32
4: 229
Right 1103912412 12:124359766-124359788 TTCCTCCAGTTGGGCCCAGGGGG 0: 1
1: 0
2: 1
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103912412 Original CRISPR TTCCTCCAGTTGGGCCCAGG GGG Intronic