ID: 1103915100

View in Genome Browser
Species Human (GRCh38)
Location 12:124372136-124372158
Sequence CTCAAGGCAGAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 721}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103915100_1103915105 -6 Left 1103915100 12:124372136-124372158 CCCTCCTTCTTCTCTGCCTTGAG 0: 1
1: 0
2: 4
3: 77
4: 721
Right 1103915105 12:124372153-124372175 CTTGAGCGCCCCCTCGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 68
1103915100_1103915108 3 Left 1103915100 12:124372136-124372158 CCCTCCTTCTTCTCTGCCTTGAG 0: 1
1: 0
2: 4
3: 77
4: 721
Right 1103915108 12:124372162-124372184 CCCCTCGGCCGTGGCCTCAGCGG 0: 1
1: 0
2: 0
3: 21
4: 181
1103915100_1103915113 24 Left 1103915100 12:124372136-124372158 CCCTCCTTCTTCTCTGCCTTGAG 0: 1
1: 0
2: 4
3: 77
4: 721
Right 1103915113 12:124372183-124372205 GGCCTCCGCGTCCTTGCCCTTGG 0: 1
1: 0
2: 0
3: 19
4: 127
1103915100_1103915115 28 Left 1103915100 12:124372136-124372158 CCCTCCTTCTTCTCTGCCTTGAG 0: 1
1: 0
2: 4
3: 77
4: 721
Right 1103915115 12:124372187-124372209 TCCGCGTCCTTGCCCTTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103915100 Original CRISPR CTCAAGGCAGAGAAGAAGGA GGG (reversed) Exonic
900185782 1:1332573-1332595 CCCAGGGCAGAGCAGAAGGCCGG - Exonic
900751683 1:4401693-4401715 CTTAAGGCAGCGAAGAAACATGG + Intergenic
900836042 1:5004888-5004910 CTCTAGGCCCAGAAGAAGCATGG - Intergenic
900893543 1:5466874-5466896 TACATGGCAGAGAAGATGGAAGG - Intergenic
901140647 1:7027108-7027130 CTCAAGCCATCTAAGAAGGATGG - Intronic
902102785 1:14006354-14006376 CTCATGGCAGATGACAAGGAAGG + Intergenic
903180704 1:21603486-21603508 GTCAGGGCAGAGGAGAGGGATGG + Intronic
903239739 1:21974834-21974856 CTTACGCCAGGGAAGAAGGAGGG - Intergenic
903306563 1:22417161-22417183 CTGAAGGCAGAGGAGAAAAATGG - Intergenic
904999188 1:34654951-34654973 CACAAGGTAGAGAAGCAGGATGG + Intergenic
905358996 1:37405353-37405375 CACTAGGCAGAGAAAAAGGCTGG + Intergenic
905510956 1:38519741-38519763 CTGAAGGGAGAGGAGAAGGGAGG + Intergenic
905580373 1:39079732-39079754 ATCAAGAAAGAGAGGAAGGAAGG - Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906406401 1:45545764-45545786 TTGAAGGCAGAGAACAAGGCTGG + Intergenic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
906648357 1:47492261-47492283 GTCATGGCAGGGAGGAAGGATGG - Intergenic
906674318 1:47682269-47682291 GTCAAGGCTGAGAAGATGGGAGG - Intergenic
906703558 1:47877450-47877472 TTCAAGGGACAGAAGAGGGAGGG - Intronic
907067382 1:51498985-51499007 CACATGGCAGAAGAGAAGGAAGG - Intronic
907389598 1:54149617-54149639 CTAAAGGGAGAGAAGGAGCATGG - Intronic
907827495 1:58032885-58032907 CTGAGGGCAGAGAAGTAGGCAGG - Intronic
908070073 1:60450676-60450698 CTCCATGAAGAGAAAAAGGAGGG - Intergenic
908255251 1:62297993-62298015 CTCTAGGCAGGGCAGGAGGAGGG + Intronic
908595810 1:65687828-65687850 CACAAGGCAAAGCAGAAGGACGG - Intergenic
910128518 1:83873826-83873848 CTCCAGGAAGAGGAAAAGGAAGG - Intronic
910353273 1:86324331-86324353 CACAAGGCGGAGAAGGAGGTGGG + Intergenic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911443029 1:97953270-97953292 ACCAAAGCAGAGAAGAAGAAAGG + Intergenic
911671199 1:100610195-100610217 CTCAAAGCAGTGATGGAGGAAGG - Intergenic
912074587 1:105856642-105856664 ATAAAGGAAGAAAAGAAGGAAGG - Intergenic
912386147 1:109272208-109272230 CCCCAGGCTGGGAAGAAGGAGGG - Intronic
912497778 1:110102481-110102503 CCCAAGGAAGTGAAGCAGGATGG - Intergenic
912852926 1:113142656-113142678 ATCAACTCAGAGGAGAAGGAGGG + Intergenic
913234180 1:116765825-116765847 CACCAGGCTGAGAAGAATGATGG + Intronic
913707197 1:121437115-121437137 CTAAAGGAAGAGAGAAAGGAAGG + Intergenic
913997577 1:143664090-143664112 CTCAAGGAAGGAAGGAAGGAGGG - Intergenic
914240533 1:145849877-145849899 CTCAAGGCAGGGAAAGGGGAAGG - Intronic
915987679 1:160482547-160482569 CATAAGGCACAGAAGTAGGAAGG + Intergenic
916421908 1:164645509-164645531 TTTAAGGCAGAGGAGAAGGGGGG + Intronic
916875004 1:168959703-168959725 CTCAAAGCAGAGCACAAGGAAGG + Intergenic
916957433 1:169853743-169853765 CTGAAGGCTGGGAAGAAGAAGGG - Exonic
917486932 1:175463831-175463853 TGCAAGGCAGAAATGAAGGAAGG + Intronic
917505275 1:175621720-175621742 ATAAAGGCAGAGAGGAAGGAGGG - Intronic
917837412 1:178952431-178952453 GTCAGGACAGAGAAGCAGGAAGG + Intergenic
917940105 1:179910212-179910234 CTTAAGGCAGAGAATATGCATGG - Intronic
918071634 1:181137543-181137565 CTCAAGGCTGGGAAGCAGCATGG - Intergenic
918143888 1:181739281-181739303 CTCCAGGAAGAGGGGAAGGAAGG - Intronic
919297478 1:195721172-195721194 GTCAAGGAAAAGAAGAAGAAAGG + Intergenic
919508233 1:198427383-198427405 CTCATGGCAGAGAAAAAGTGGGG + Intergenic
920364254 1:205439841-205439863 ATGAAGGGAGAGAGGAAGGAAGG + Intronic
920460439 1:206135467-206135489 CTCAAGCAAGACAAGCAGGAGGG + Intergenic
920693629 1:208165150-208165172 CTCCAGGCTGAGAAGGAGGGAGG - Intronic
921134330 1:212246745-212246767 CTCAAGGCAGCAAAGAAAGGGGG - Intergenic
921359781 1:214320033-214320055 CCAAAGGCAGAAAAGAAAGAAGG + Intronic
921404857 1:214767524-214767546 AAGAAGGAAGAGAAGAAGGAAGG - Intergenic
921448493 1:215274697-215274719 GTGAAGGGAGAAAAGAAGGAAGG - Intergenic
921648285 1:217646163-217646185 TTCAAGACAGAAATGAAGGATGG - Intronic
922349784 1:224725824-224725846 CTAAAGGAAAAGAAGTAGGAAGG - Intronic
922817184 1:228458187-228458209 ACCAAGGCACAGAAGAAGGACGG + Exonic
922817973 1:228464515-228464537 ACCAAGGCGCAGAAGAAGGACGG - Intergenic
923360986 1:233210937-233210959 CTCAGTGCAGAGAAGGAGCAAGG + Intronic
924135479 1:240961904-240961926 AAGAAGGCAGAGAGGAAGGAAGG + Intronic
924253747 1:242161231-242161253 CACAAGGCAGAGGAGGAGAAAGG + Intronic
924573091 1:245256068-245256090 CACAAGGCAGGTAGGAAGGAGGG - Intronic
1062999351 10:1900040-1900062 CCAAAGGCAGAGGGGAAGGAAGG + Intergenic
1063243439 10:4194244-4194266 ATGAAGTCAGAGAAGAAGGTGGG - Intergenic
1064099321 10:12450089-12450111 CCCAAGGAAGGAAAGAAGGAAGG + Intronic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1066455083 10:35565558-35565580 CTCCAGGGAGAAAAGAAGGGAGG - Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066954143 10:42149500-42149522 CCGATGGGAGAGAAGAAGGAGGG - Intergenic
1067519560 10:46986840-46986862 CTCATGGTACAGAAGAATGATGG + Intronic
1067642687 10:48064999-48065021 CTCATGGTACAGAAGAATGATGG - Intergenic
1067690298 10:48497472-48497494 CAGAAGGCAGAGGGGAAGGAGGG + Intronic
1067771655 10:49131023-49131045 CTCAAGGTAGAGCAGGAGGCTGG - Intergenic
1068454309 10:57235384-57235406 GTCAAGAAAGAGAAGAAAGAGGG - Intergenic
1068650674 10:59519242-59519264 CCTAAGGCTGAGAAGATGGAGGG - Intergenic
1068725585 10:60298433-60298455 TTCAAGTCAGAGATGAAGGCAGG + Intronic
1069229067 10:65983853-65983875 CTCAAGGAAGCAATGAAGGAAGG + Intronic
1069298992 10:66883293-66883315 CTCAGGGCAGAGATCATGGAAGG + Intronic
1069620519 10:69834714-69834736 GACAAGGCAGAGCAGAAGGGGGG + Intronic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1069943215 10:71969438-71969460 CTCAGGGCAGAGATGAGGGTGGG - Intronic
1070436237 10:76396713-76396735 CCCAGGGCAGACAAGAAGGAAGG + Intronic
1070481246 10:76884755-76884777 AGGAAGGAAGAGAAGAAGGAAGG + Intronic
1070940191 10:80337691-80337713 CTCCAGGCAGAGAGCATGGAAGG - Intronic
1071510657 10:86260593-86260615 CTCAAGGCAGAGGCCAGGGAGGG + Intronic
1071994803 10:91137275-91137297 ATAAAGGAAGGGAAGAAGGAAGG + Intergenic
1072748896 10:97962196-97962218 CTCCAGGCAGAAAAAAGGGAGGG + Intronic
1072983252 10:100117311-100117333 CACTGGGCAGAGTAGAAGGAAGG + Intergenic
1073327568 10:102651367-102651389 CTCAGGGCACAGCAGAGGGAGGG - Intronic
1074163176 10:110851145-110851167 CTCAAACCACAGAAGAAGGGCGG - Intergenic
1074185292 10:111095926-111095948 CTCAAGGAAGAGAGGAATGTTGG + Intergenic
1074207535 10:111297005-111297027 CTCAAGGTAGAGATGAAGGCAGG + Intergenic
1074754501 10:116614460-116614482 CTCATGGCAGATGAGATGGAAGG - Intergenic
1075136080 10:119787575-119787597 CTCAAAGAAGGAAAGAAGGAAGG + Intronic
1076189736 10:128474713-128474735 TGCAAGGCAGAGAGGAAGGGAGG - Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076306827 10:129471340-129471362 CTCAGGGCAGAGAAGGAGATGGG + Intronic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076453927 10:130576190-130576212 CCCAAGGCACTGAAGAAGGCTGG - Intergenic
1076478264 10:130767439-130767461 TTCAAGGCTGAGGAGAGGGAGGG - Intergenic
1076637829 10:131893919-131893941 CTGAAGGAAGGGAAGAAAGATGG - Intergenic
1077676323 11:4196472-4196494 AGCAAGGTAGAGAAGATGGAGGG - Intergenic
1078098517 11:8314952-8314974 GGCAAGGCAGAGAAAAGGGAAGG - Intergenic
1078335828 11:10462511-10462533 CCCAAGGCAGAGATGGAGGCAGG + Intronic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079590426 11:22176651-22176673 CTCATGGCAGAAAAGCAGAAAGG + Intergenic
1079615023 11:22481510-22481532 TGAAAGGCAGAGAAAAAGGAAGG + Intergenic
1080668730 11:34357684-34357706 CGCGACGCAGAGAGGAAGGAGGG - Exonic
1081587625 11:44398257-44398279 TTCAAAGCAGAGACGCAGGAGGG - Intergenic
1082105621 11:48218147-48218169 ATGAAGGAAGAAAAGAAGGAAGG - Intergenic
1082899997 11:58237748-58237770 CTGAAGGAAGAGTAGAAGCATGG - Intergenic
1083542170 11:63519598-63519620 CTGGAGGGAGAAAAGAAGGAAGG + Intergenic
1083949629 11:65946939-65946961 CTCAAGGCAGACAGCAAAGAAGG + Exonic
1084167702 11:67383715-67383737 CTCAAGGCAGAGGACACAGAGGG + Intronic
1084276374 11:68053158-68053180 CTCCAGGCAGAGCAGAGGGCAGG + Exonic
1084552284 11:69851940-69851962 CTCCAGGCAGAAAGGAAGGCGGG - Intergenic
1084689020 11:70714169-70714191 TTCCAGACAGGGAAGAAGGAAGG - Intronic
1085491589 11:76924095-76924117 CTCAAGCCACAGCATAAGGAGGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1085782858 11:79425093-79425115 TTCAAGACAGAAAAGCAGGAGGG - Intronic
1086399681 11:86450249-86450271 CTCCAGGAAGAGAATAAGAATGG - Intronic
1087016197 11:93556588-93556610 GCCAAGGCAGAAAAGAAAGAGGG + Intergenic
1087358941 11:97133535-97133557 CACAAGGAATACAAGAAGGAAGG - Intergenic
1087462046 11:98457618-98457640 CTGAAAGAAGACAAGAAGGAGGG - Intergenic
1088381272 11:109195093-109195115 ATGAAGGAAGGGAAGAAGGAAGG - Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1090001098 11:122959507-122959529 CTCAACGCAGAGAAGGTGGTTGG - Exonic
1090040001 11:123282389-123282411 GTCAAGACAGAGAAGAATGTAGG + Intergenic
1090606624 11:128428732-128428754 TTGAAGGCAGAGAATATGGATGG - Intergenic
1090776319 11:129968961-129968983 CTCAAGGCAGCAAAAAAGGCTGG + Intronic
1090859418 11:130639872-130639894 TTCGAGGCAGGGAAGAAGGGTGG - Intergenic
1090878484 11:130812756-130812778 GCCAAGGCAGAGAGGAAGGAGGG + Intergenic
1091357092 11:134945431-134945453 CGAAAGACAGAGAAGAAAGAGGG - Intergenic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1091874852 12:3925168-3925190 CTCCAAGCAGAGCAGAAAGAAGG - Intergenic
1092989663 12:13883440-13883462 CCAAAGGCAGGTAAGAAGGAAGG - Intronic
1093110183 12:15142684-15142706 CTCAAGAAAGAGAAGAGAGAGGG + Intronic
1093170911 12:15859376-15859398 CACAAGAGAGAGAAGAAGCACGG + Intronic
1093996021 12:25643722-25643744 CTGATGGCAAAGAAGAAGGGAGG + Intronic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1094586285 12:31780676-31780698 ATAAAGGCAGGGAGGAAGGAAGG - Intergenic
1095238250 12:39824862-39824884 CTTCAGGCAGAGATCAAGGAGGG + Intronic
1095324453 12:40871352-40871374 CTCTAGGGAGAGGAGAAGTATGG + Intronic
1096037320 12:48483782-48483804 ATGAAGTCAGAAAAGAAGGAGGG + Intronic
1096059066 12:48681382-48681404 CCAAAGCCAGAGAAGAAAGATGG - Exonic
1096075493 12:48801235-48801257 CTCAACGCTGAGCACAAGGAAGG + Intergenic
1096218233 12:49810034-49810056 TTCCAGGAAGGGAAGAAGGAAGG + Intronic
1096785157 12:54013110-54013132 CCCAAGGCTGAGGAGGAGGAGGG - Intronic
1096819968 12:54226315-54226337 CTCAAAACAGAGAAGAGGGGTGG - Intergenic
1097169495 12:57105003-57105025 GTCAAGGCAGAGGAAAGGGAGGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097354290 12:58584223-58584245 CTCAAAGGAGAGAAAATGGAAGG - Intronic
1097629245 12:62039665-62039687 CTCAAGGTAAAGAAGAGAGATGG + Intronic
1097852214 12:64423452-64423474 CTCAAAGCAAAAAAAAAGGAGGG - Intronic
1097919980 12:65061457-65061479 CTCAAGAAAGAGCAAAAGGAAGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098907989 12:76181044-76181066 AGGAAGGAAGAGAAGAAGGAAGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099205451 12:79721392-79721414 CTCAAGGCAGAAAAGGCAGAAGG - Intergenic
1100897852 12:99204692-99204714 CTAAAGGCAGAGATGCTGGAAGG + Intronic
1101044435 12:100790078-100790100 CTCCAGGGAGAGAAGCAGGAAGG + Intronic
1101543489 12:105686309-105686331 TTCAAGGTAGAAAAGAAGAAAGG - Intergenic
1101970861 12:109310769-109310791 CTCCTGGCAGAGAAGAAAGGAGG - Intergenic
1103279164 12:119740832-119740854 CTCAAGGAAGGGAGGAGGGATGG + Intronic
1103510708 12:121471750-121471772 CTCAGGGCAGAGAAACAGAATGG + Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104235825 12:126935681-126935703 CACAGTGCAGAGAAGAAGAAAGG + Intergenic
1104491199 12:129195104-129195126 CATAGGGCAGGGAAGAAGGATGG + Intronic
1104703075 12:130921930-130921952 CTTCAAGCAGAAAAGAAGGAGGG + Intergenic
1104880996 12:132070063-132070085 CTCTAGGCAGAGAGGAAGACGGG - Intronic
1104939778 12:132389703-132389725 CTCAAGGCAAGGATGAGGGAAGG + Intergenic
1106125185 13:26895460-26895482 CCCACGGCAGAGGGGAAGGAAGG - Intergenic
1106387299 13:29300371-29300393 CTCAAGGCTGACAAGCAGGGTGG - Intronic
1106500990 13:30328401-30328423 CTCTAGGCTGAGCAGAAGGAAGG + Intergenic
1106887948 13:34210446-34210468 CACATGGTACAGAAGAAGGAAGG - Intergenic
1107067556 13:36231664-36231686 CTCAAGTCAGAGTGTAAGGAAGG - Intronic
1107434717 13:40372266-40372288 CCCAAGGCAGAGAAGTGTGATGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1108128382 13:47269764-47269786 CTCAAGACAGAGAATGAGAAAGG + Intergenic
1108548326 13:51518730-51518752 CACAAAGCAGAGAAAAGGGAAGG - Intergenic
1108573985 13:51776408-51776430 CTCATGGGAGGGAAGGAGGAGGG - Intronic
1109044761 13:57395310-57395332 CTCAAGACAGAGAACTAGGAGGG - Intergenic
1109718493 13:66247071-66247093 CAGAAGGCAAAGAGGAAGGAAGG - Intergenic
1110810934 13:79809875-79809897 CTGAAGGATGAGATGAAGGAAGG - Intergenic
1111203368 13:84969660-84969682 CTGGAGGTAGAGAAGAAGGGTGG - Intergenic
1111364899 13:87230159-87230181 GAAAAGGCAGACAAGAAGGAAGG - Intergenic
1112382575 13:98906183-98906205 CGCAAGGCTGAGAGGAAGGCTGG + Intronic
1113783682 13:112990723-112990745 CCCAAGTAAGTGAAGAAGGACGG - Intronic
1113797978 13:113069808-113069830 CTAGAGGGAGAGAAGCAGGAAGG + Intronic
1113867505 13:113536915-113536937 CTCACGGCACAGCAGCAGGACGG - Intronic
1114192074 14:20447326-20447348 ATGAGGGCAGAGAAGAATGAAGG - Intronic
1114548742 14:23521457-23521479 CCCAAGGCAAAGAAGGGGGAAGG - Exonic
1116111448 14:40590559-40590581 CTCCAGGGAGGGAAGAAGGATGG + Intergenic
1116211091 14:41945709-41945731 CAGAAGGAAGAGGAGAAGGAAGG - Intergenic
1116659575 14:47692041-47692063 AGCAAGGGAGGGAAGAAGGAAGG - Intergenic
1116770188 14:49118480-49118502 ATGAAGGCAGAGAGGAAAGAGGG - Intergenic
1117808790 14:59523206-59523228 CTCAAGGTCTAGAAGAATGAAGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118009663 14:61596877-61596899 AAAGAGGCAGAGAAGAAGGAGGG + Intronic
1118822153 14:69352618-69352640 CTGAAGGCTGGGAAGAGGGAAGG + Intronic
1119617011 14:76105349-76105371 GTTAAAGCAGAGAAGAGGGAGGG + Intergenic
1120052400 14:79882443-79882465 GTCAAGCAAGACAAGAAGGAAGG - Intergenic
1120674327 14:87403343-87403365 CACAAGGAAGAGAAGTAGGTAGG - Intergenic
1121448555 14:93993660-93993682 CACCAGGCACAGCAGAAGGAAGG - Intergenic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1121671433 14:95713761-95713783 CTCCAGGCAGGGAAGAAGGGTGG - Intronic
1122096426 14:99376408-99376430 AGGAAGGCAGAAAAGAAGGAAGG + Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1123539385 15:21273172-21273194 AACAAGGCAGAGCAGAAGGATGG - Intergenic
1124079844 15:26482071-26482093 CTAAAGGAAGGAAAGAAGGAAGG + Intergenic
1124471088 15:29986763-29986785 CTCAAAAAAGAAAAGAAGGAAGG - Intergenic
1124637018 15:31371842-31371864 ATCAAGGCAGAGATGAAGGTGGG - Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1125066353 15:35490198-35490220 CTAAAGGAAGAAAGGAAGGAAGG + Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1126111868 15:45179902-45179924 AGCAAGGCAGAGATGAAGAAAGG + Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127161539 15:56192384-56192406 CTGATGGCAGAGAAGAAGCTTGG - Intronic
1127618537 15:60710805-60710827 CCCAGGGCACAGAAGAGGGAGGG + Intronic
1127637343 15:60883954-60883976 CTCAAATCAGAGAAGAATGCTGG - Intronic
1128345074 15:66848359-66848381 ATCAAGGCGGTGAAGAAGGAAGG - Intergenic
1128358298 15:66943549-66943571 CTGAAGGGAAAGAAGAGGGAGGG - Intergenic
1129011251 15:72419678-72419700 CTCTATGCAAAGAAAAAGGAGGG + Intergenic
1129124859 15:73430863-73430885 TGCCAGGCAGAGAAGTAGGAAGG + Intergenic
1129816698 15:78561690-78561712 GGCAAGGCAGAGGAGGAGGAGGG + Intergenic
1129880961 15:79005750-79005772 ATAAAGGGAGAGAGGAAGGAAGG - Intronic
1129910275 15:79220983-79221005 GGAAGGGCAGAGAAGAAGGATGG + Intergenic
1129933061 15:79428294-79428316 AGGAAGGGAGAGAAGAAGGAAGG - Intergenic
1130043665 15:80427476-80427498 CTCAAGACTGAAAAGAAGGGAGG + Intronic
1130216183 15:81972193-81972215 ATCATGGCAGAGGGGAAGGAGGG + Intergenic
1130314879 15:82786717-82786739 ATCAAGACAGAGAAGAACCAAGG + Intronic
1130874633 15:88002860-88002882 CCCAAGCCAGAGAAAGAGGAAGG + Intronic
1131155032 15:90069656-90069678 TTCAAAGCAGAGAAGATGTAAGG + Intronic
1131425852 15:92344955-92344977 CACAAGGCAGAGACGAGGAAGGG + Intergenic
1131577522 15:93606469-93606491 CTCAGGGCAGAGAGGAAGCTGGG + Intergenic
1131581921 15:93651755-93651777 CCAAAGGAAGAGAAGAAGCAGGG - Intergenic
1131773332 15:95765211-95765233 CAGAAGGCAAAGAAGAAGCAAGG + Intergenic
1131967465 15:97859436-97859458 GACAAGGTAGAGAAGCAGGAAGG - Intergenic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132436070 15:101803798-101803820 CTCCAGGCAGAGAATAAAGTCGG + Intergenic
1202947695 15_KI270727v1_random:331-353 AACAAGGCAGAGCAGAAGGATGG - Intergenic
1133216031 16:4293079-4293101 CTCAAAAAAGAAAAGAAGGAAGG - Intergenic
1133495404 16:6312779-6312801 CCCAAGGAAGAAAAGATGGAAGG - Intronic
1133606436 16:7392589-7392611 CTCTAGCCCAAGAAGAAGGAGGG - Intronic
1133900345 16:9968213-9968235 TGCAGGGGAGAGAAGAAGGAAGG - Intronic
1134383652 16:13751490-13751512 ATCAAGACAGAGAAGAGAGAGGG + Intergenic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135745344 16:25012179-25012201 CCCAAAGAAGAGAAGTAGGATGG - Intronic
1136071192 16:27788278-27788300 CTCAAGAAAGAGAAGAAAGTGGG - Exonic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1136221111 16:28829612-28829634 CACAAGGCAGAGTAGGAGTAGGG - Intronic
1136694677 16:32066976-32066998 TTCAGGGAAGAGAAGAAGAAAGG - Intergenic
1136715560 16:32278892-32278914 GCCAGGGGAGAGAAGAAGGAGGG + Intergenic
1136752348 16:32650875-32650897 GCCAGGGGAGAGAAGAAGGAGGG - Intergenic
1136795179 16:33010238-33010260 TTCAGGGAAGAGAAGAAGAAAGG - Intergenic
1136822243 16:33329587-33329609 GCCAGGGGAGAGAAGAAGGAGGG + Intergenic
1136828806 16:33386126-33386148 GCCAGGGGAGAGAAGAAGGAGGG + Intergenic
1136833872 16:33484908-33484930 GCCAGGGGAGAGAAGAAGGAGGG + Intergenic
1136870046 16:33798597-33798619 TTCAGGGCAGAGAAGAAGAAAGG - Intergenic
1136874737 16:33844144-33844166 TTCAGGGAAGAGAAGAAGAAAGG + Intergenic
1137541994 16:49369918-49369940 GCCAAGGCAGAAAAGCAGGAGGG + Intergenic
1137674610 16:50298111-50298133 ATCAATGCAGAGAGGAAAGAGGG - Intronic
1137773991 16:51040810-51040832 GCAAAGGCAGAAAAGAAGGAAGG + Intergenic
1138024514 16:53512055-53512077 CTGAGGGCAGATGAGAAGGATGG - Intergenic
1138183696 16:54960742-54960764 CACAAGGCTGAAAAGAAGAAGGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139273373 16:65704159-65704181 CTGAAGGCAGAGGAGGAGAAAGG - Intergenic
1139330308 16:66183508-66183530 GGCAAGGCAGAGAGAAAGGAAGG + Intergenic
1139344808 16:66296149-66296171 CTCAAGACAGGGAAGGAGCAAGG - Intergenic
1139387103 16:66579677-66579699 CCCGAGGAAGACAAGAAGGACGG + Exonic
1139813914 16:69651173-69651195 ATGAAGGCAAAGAAGAAGAAAGG - Intronic
1140263964 16:73404259-73404281 CTTAAGGCACAGAAGAGGGCTGG + Intergenic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141165506 16:81658066-81658088 CCCTAGGCAGAGACGCAGGAAGG - Intronic
1141882891 16:86871658-86871680 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1141999624 16:87656745-87656767 CACAAGGCAGAGGAGAAAGGCGG - Intronic
1203011044 16_KI270728v1_random:239612-239634 GCCAGGGGAGAGAAGAAGGAGGG - Intergenic
1203054494 16_KI270728v1_random:910859-910881 GCCAGGGGAGAGAAGAAGGAGGG - Intergenic
1203102124 16_KI270728v1_random:1317457-1317479 TTCAGGGCAGAGAAGAAGAAAGG + Intergenic
1143527770 17:7482412-7482434 CTCAAGGCAGAGGGTGAGGACGG - Exonic
1143675491 17:8429536-8429558 CAAAAGGCAGAGGAGAAGGTGGG + Intronic
1143684656 17:8504218-8504240 CACAAGGGTGAGAAGAAGGCTGG - Intronic
1143706010 17:8698124-8698146 GACAAGGCAGAGCAGAAGAAAGG - Intergenic
1143901207 17:10176114-10176136 CTGAAGGCAGGGAAGGATGAAGG + Intronic
1144132060 17:12255599-12255621 GGCAAGGGAGAGAGGAAGGAAGG - Intergenic
1144389686 17:14781670-14781692 TTTTAGGCAGAGAAGAATGATGG - Intergenic
1145279674 17:21458173-21458195 CTCAGGGCAGGGAAGAAGGAGGG + Intergenic
1145994287 17:29096668-29096690 CTCCAGGGAGGAAAGAAGGAAGG - Intronic
1145997542 17:29113248-29113270 CTCATGGCAGAGAAGAGGGAGGG + Intronic
1146672742 17:34753015-34753037 CTCAGGGTAGCGAAGAGGGAAGG - Intergenic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1146979505 17:37146704-37146726 AGAAAGGGAGAGAAGAAGGAGGG + Intronic
1147505689 17:41014961-41014983 TGCAAGGCAGAGGAGTAGGAAGG + Intronic
1147744239 17:42685312-42685334 TTCAAGACCGAGGAGAAGGACGG + Exonic
1148966954 17:51443639-51443661 CTGAAGGCAGTGAAACAGGATGG + Intergenic
1149455021 17:56780734-56780756 CACAGGGCTGAGAGGAAGGAAGG + Intergenic
1149579750 17:57741396-57741418 CTCAAGGCAGGAAACAAGGATGG - Intergenic
1150105785 17:62461586-62461608 CTTAAGGAAGAAAGGAAGGAAGG - Intronic
1151305188 17:73258651-73258673 CTCCAGGCAGATGGGAAGGATGG - Intronic
1151337173 17:73446843-73446865 CCCAAGACAGAGAAGGAGGGAGG - Intronic
1152476177 17:80519747-80519769 GGCCAGGTAGAGAAGAAGGAAGG - Intergenic
1152631240 17:81411555-81411577 CTCAAGGAAGGAAGGAAGGAAGG - Intronic
1153190580 18:2533393-2533415 CTCTAGGGAGGGAAGAAGGGAGG + Intergenic
1153501688 18:5756205-5756227 TTCTAGGCACAGGAGAAGGAGGG - Intergenic
1154115511 18:11610023-11610045 CTCAAGGCAGAGGGTGAGGATGG - Intergenic
1154165632 18:12012265-12012287 CTGAAGCCAGAAAGGAAGGATGG - Intronic
1154497585 18:14973870-14973892 CGAAAGACAGAGAAGAAAGAGGG + Intergenic
1154985064 18:21542868-21542890 ATTAAGGCAGAGGAGAAGCAGGG + Intronic
1155436172 18:25815420-25815442 TCCAAAGCAGAGAAGAGGGAAGG + Intergenic
1155762151 18:29582089-29582111 AGGAAGGGAGAGAAGAAGGAAGG + Intergenic
1155885157 18:31198729-31198751 CTCAAGACAGGAAAGGAGGAGGG - Intergenic
1156053137 18:32963260-32963282 CTCAAAGCAGAGAAGTATGAGGG - Intronic
1156503953 18:37577407-37577429 CGGATGGCACAGAAGAAGGAAGG - Intergenic
1156612009 18:38735738-38735760 CCAAAGGCAGAGAAGCAAGAGGG + Intergenic
1157137482 18:45070980-45071002 ATGAAGGGAGGGAAGAAGGAAGG - Intergenic
1157443027 18:47724631-47724653 CTCCAGCCAGAGGAGCAGGAGGG + Intergenic
1157941726 18:51936001-51936023 CCCAAAGCAGAGATGAAGCAGGG - Intergenic
1158421381 18:57297661-57297683 CTCAAGGGAGAGAAAAAGCAAGG - Intergenic
1159785205 18:72705307-72705329 CTAAATGGAGAGAAGAAAGAAGG + Intergenic
1159852375 18:73539878-73539900 CTCAACCCAGGGAACAAGGAGGG + Intergenic
1160009109 18:75090163-75090185 CTCACGGCAGAGGAGAGGGAAGG + Intergenic
1160144666 18:76353664-76353686 CACACGGCAGAGAGGAAGCAAGG - Intergenic
1160261167 18:77295624-77295646 ATAAAGGAAGAGGAGAAGGAAGG + Intergenic
1160301426 18:77684230-77684252 CACATGGCAGAGAGGAAGCAAGG + Intergenic
1161901969 19:7125790-7125812 CTGAAATCAGACAAGAAGGATGG - Intronic
1161934434 19:7362873-7362895 CCCATGGCAGAGAAGAAGTCTGG - Exonic
1162265973 19:9574652-9574674 GTAAAGGCAGAGGAGAAGAAAGG + Intronic
1163204909 19:15795219-15795241 AAGTAGGCAGAGAAGAAGGAAGG - Intergenic
1163409255 19:17143400-17143422 CTCAAAGCCGAGAAGGAGGGAGG + Intronic
1164552274 19:29221651-29221673 GACAAGGCAGAGGAGAAGGTAGG - Intergenic
1165293295 19:34906089-34906111 CTGAAGACAGAGAAGATGCAGGG + Intergenic
1166287969 19:41844148-41844170 GCCAAGGCAGAGAAGATGGCGGG + Exonic
1166779095 19:45330973-45330995 CTCAAAGAAAAGAAGAAGGCCGG + Intergenic
1167408932 19:49333677-49333699 CTCAGGACAGAGAAGAGGGGTGG + Intergenic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
925051508 2:819286-819308 TTAACGGCAGAGAAGCAGGAGGG - Intergenic
926112971 2:10194549-10194571 CATAAGGCAGTGAAGCAGGACGG - Intronic
926161894 2:10495134-10495156 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
926188367 2:10708984-10709006 CTGAAGGGAGAGAAAAGGGAAGG + Intergenic
926316746 2:11715609-11715631 CTCATGGGAGAGGAGAAGTAGGG + Intronic
926776988 2:16432564-16432586 CACATGGCACAGAGGAAGGATGG + Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
928169725 2:28995448-28995470 AGGAAGGCAGAGAAGCAGGATGG + Intronic
928191990 2:29179213-29179235 TTCAAAGCAGTGAAAAAGGAGGG - Intronic
928209238 2:29311602-29311624 CTCAAGGCAGGGAGGAAGTCTGG - Intronic
928295411 2:30078734-30078756 CTAAAGGCAGAAAGCAAGGATGG + Intergenic
928420127 2:31131919-31131941 CTCAAATCAGAGAAGACAGAGGG - Intronic
928473487 2:31598729-31598751 CTAAAGGAAGACAGGAAGGAAGG + Intergenic
929260304 2:39859528-39859550 CTCCAGGAAGGGAAGACGGAAGG - Intergenic
929275404 2:40020109-40020131 TCCAATGCAGAGAAGAAGGAAGG + Intergenic
929404012 2:41620236-41620258 CAGAAGGCAGAGAAGAATGAAGG + Intergenic
929552991 2:42906091-42906113 CTCTAGGCAGAGGGGAAAGAAGG + Intergenic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
931020114 2:58034726-58034748 CTCAAGGCAGTGCTAAAGGAAGG + Intronic
931884608 2:66603495-66603517 GAAAAGGAAGAGAAGAAGGAAGG - Intergenic
932097416 2:68863937-68863959 CTCCAGGCAGGGAACATGGATGG - Intergenic
933027307 2:77276307-77276329 TGAAAGGAAGAGAAGAAGGAAGG + Intronic
933188618 2:79307379-79307401 CTAAAGGTAGAGGAAAAGGAAGG - Intronic
933366016 2:81355066-81355088 AACAAGGCAAATAAGAAGGAGGG + Intergenic
933533376 2:83538864-83538886 CTCTAGGGAAAAAAGAAGGAAGG + Intergenic
935200077 2:100848886-100848908 CTCAAGGCAGAGAACATGTCAGG - Intronic
935241291 2:101180259-101180281 CTCTAGGCAGAGGAGAAAAATGG + Intronic
935308494 2:101759844-101759866 GTCAAGACAGAGGAGACGGATGG - Intronic
935368835 2:102323569-102323591 CACATGGGAGAGAAGAAGCAAGG + Intronic
935641250 2:105292555-105292577 CAAAAGGCAGAGAAGAAGGGAGG + Intronic
936141528 2:109946210-109946232 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936178217 2:110244158-110244180 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936203166 2:110425273-110425295 GTCTAGGCAGAGATGAAGGATGG + Intronic
936500871 2:113065285-113065307 ATCTAGGCAGAGAGGATGGATGG - Intronic
936886788 2:117319906-117319928 AGGAAGGCAGAGAGGAAGGAAGG + Intergenic
936946990 2:117940139-117940161 CTTGAGTCAGAGAAGAAAGAGGG + Intronic
937277206 2:120692677-120692699 GGCCAGTCAGAGAAGAAGGAGGG - Intergenic
937324426 2:120981813-120981835 AGCAAGGGAGAGAGGAAGGAAGG - Intronic
937593934 2:123650148-123650170 CTCAAGGCATAGAAAAACAAGGG - Intergenic
937623059 2:124012085-124012107 GTCAAGGAAGAAAGGAAGGAAGG - Intergenic
937860352 2:126703360-126703382 CTCCAGGCAGGGAGGAAGCAGGG + Intergenic
938230788 2:129656991-129657013 CTTAAGCCACAGAAGAAGGTGGG + Intergenic
938723076 2:134083650-134083672 CTCAGGGAAGAGAAAAAGGCTGG - Intergenic
938724227 2:134092505-134092527 CGCCAGGCAGAGATGAAGAAAGG - Intergenic
938999475 2:136717453-136717475 CTCAAAGGCAAGAAGAAGGACGG + Intergenic
939488721 2:142850572-142850594 TGCAAGGCAGAGAATAATGAAGG + Intergenic
940722959 2:157301682-157301704 AGCAAGGCAGGAAAGAAGGAAGG - Intronic
940781094 2:157934360-157934382 CTCAAGGCAGAGGAGGAAGCTGG + Intronic
940897504 2:159094846-159094868 CTCAAGGGAGAGAAGCAGACAGG - Intronic
941166763 2:162091245-162091267 CTCAAGGCAGTGAAGGAGATGGG - Intergenic
941376712 2:164740462-164740484 CTCCAGGCAGAGAGCAAGGTAGG - Intronic
941470993 2:165886875-165886897 ATGAAGGCAGAGCAGAAGTAGGG - Intronic
941589244 2:167398360-167398382 ATCAATGAAGGGAAGAAGGAAGG - Intergenic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942185684 2:173422776-173422798 CACAAGGGAGACAGGAAGGAGGG + Intergenic
943329913 2:186546784-186546806 CTAAAGGAAGTGAAGAAGAATGG - Intergenic
943510468 2:188819939-188819961 CTCAAAGCAGGCAGGAAGGAGGG + Intergenic
944128964 2:196325228-196325250 AACAAGGGACAGAAGAAGGAAGG + Intronic
944843424 2:203645124-203645146 TTTATGGCAGAGAAGAATGAAGG - Intergenic
945058703 2:205889859-205889881 CTCAAGGAAGGAAGGAAGGAAGG + Intergenic
945109816 2:206351561-206351583 TACAAGGAAGGGAAGAAGGAAGG - Intergenic
945120553 2:206452888-206452910 CACAATGCAGAGAAGAGGGGAGG - Intronic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
945743716 2:213694787-213694809 GGCAAGGGAGAGTAGAAGGAAGG - Intronic
945769580 2:214024899-214024921 CTCAAGGCAGAAAAGACTGGAGG - Intronic
947236685 2:227948789-227948811 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
947441904 2:230130885-230130907 CTCAAAGCAGGCAGGAAGGAAGG - Intergenic
947614912 2:231549676-231549698 CTGAAGGCAGACAGGAAGGCAGG + Intergenic
948017644 2:234703034-234703056 CCCGAGGCAGAAGAGAAGGAAGG + Intergenic
948039244 2:234886362-234886384 CCAAAGCCAGAGAAGAAGCAGGG + Intergenic
948067359 2:235091151-235091173 AGAAAGGCAGACAAGAAGGAAGG - Intergenic
948132975 2:235614471-235614493 CTCAAGGGAGAGAAAAGGCAAGG + Intronic
948384776 2:237574705-237574727 CTCTGGACAGAGAGGAAGGAAGG - Exonic
948565516 2:238883949-238883971 TTTAATGCAGAGGAGAAGGAAGG - Intronic
948857910 2:240738842-240738864 CTCAAGGCAGACAGGAGAGAAGG - Intronic
1168818375 20:756479-756501 CTCAAGGCAGGTAGGAGGGAAGG - Intergenic
1170182490 20:13547984-13548006 TTAAAGAGAGAGAAGAAGGAAGG + Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170699071 20:18687097-18687119 ATTCAGGCAGAGGAGAAGGATGG + Intronic
1170957565 20:20995342-20995364 CTAGAGGCAGAAGAGAAGGAGGG + Intergenic
1171804071 20:29658669-29658691 CCCAAGACACAGAAGAAGGCAGG + Intergenic
1171901801 20:30865390-30865412 ATGAAGGAAGAGAGGAAGGAAGG + Intergenic
1172055423 20:32151144-32151166 CTCAAGCAAGAGAAGAAATAGGG + Intronic
1172115959 20:32573861-32573883 CTGAGGGGAGAGAAGAAGGGAGG - Intronic
1172262579 20:33581062-33581084 CTCAAGACAGGAAAGAAAGAAGG - Intronic
1173564063 20:44026822-44026844 CTCACCCCACAGAAGAAGGAAGG - Intronic
1173616672 20:44407595-44407617 CTAATGGCTGAGAAGAGGGAGGG + Intronic
1173837907 20:46137883-46137905 ATCAAGGCAGAGTAGGAGAAAGG - Intergenic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1174067766 20:47878170-47878192 CACAAGGCAGAGGAGAAGGCTGG + Intergenic
1174161675 20:48555459-48555481 CTGAAGGCTGAGCAAAAGGAGGG - Intergenic
1174280811 20:49437767-49437789 CCCAAGGGACAGAAGAAGCAAGG - Intronic
1174849022 20:53973787-53973809 CTCAAGAAAGAAAAGAAGGAAGG + Intronic
1175473653 20:59253034-59253056 GGGAAGGAAGAGAAGAAGGAAGG + Exonic
1175496851 20:59420512-59420534 AGGAAGGAAGAGAAGAAGGAAGG - Intergenic
1175545088 20:59772970-59772992 TTCATAGCAGAGAAGCAGGAAGG + Intronic
1175669483 20:60889821-60889843 AGCTAGGCAGAGAAGAAGGAAGG + Intergenic
1175889750 20:62310879-62310901 GTGAGGGCCGAGAAGAAGGAAGG - Intronic
1176294547 21:5064420-5064442 CTCTTGGCGGAGAAGAAGGAGGG - Intergenic
1176843317 21:13857820-13857842 CACAAGACAGAGAGGAAAGAGGG + Intergenic
1178304436 21:31479686-31479708 CTGAAGGAAGTGAAAAAGGAAGG + Intronic
1178640358 21:34340305-34340327 CTCAAGGCAGAGAGGATGCCTGG - Intergenic
1178740326 21:35194025-35194047 CGGAAGGCAAAGAGGAAGGAAGG + Intronic
1178766120 21:35452461-35452483 CACATGGCAGAGAAGAATGAAGG - Intronic
1179368850 21:40785340-40785362 CTCAAGGAAGGGTACAAGGATGG - Intronic
1179409757 21:41153667-41153689 GGAAAGGAAGAGAAGAAGGAAGG + Intergenic
1179862505 21:44197706-44197728 CTCTTGGCGGAGAAGAAGGAGGG + Intergenic
1180393716 22:12309712-12309734 CTCCTGGCAGGGAAGAAGGAAGG - Intergenic
1180406029 22:12555036-12555058 CTCCTGGCAGGGAAGAAGGAAGG + Intergenic
1180702277 22:17788031-17788053 TTGAAGGCAGGGAAGCAGGATGG - Exonic
1181452367 22:23032285-23032307 CTCAAAGCAGGGAAGGTGGAGGG - Intergenic
1182017039 22:27049409-27049431 CTAAAGGAAGAGGGGAAGGAAGG - Intergenic
1182076163 22:27496846-27496868 CTCCAGGCACTGAAAAAGGAAGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182171301 22:28232676-28232698 CTCAAGACAGAACAGATGGATGG + Intronic
1182294237 22:29303736-29303758 CTCATGGGAGAGAAGGAGGAAGG + Intergenic
1182394542 22:30025997-30026019 TTGAAGGCAGAGGAGGAGGATGG - Exonic
1182693211 22:32177755-32177777 CTCCAGGAAGGGAAGAAGGAAGG + Intergenic
1182979029 22:34650736-34650758 AGCAAGGCAGAGAAGAGGGGAGG + Intergenic
1183385315 22:37510751-37510773 CTCATGGCAGAAAAGGAGGAGGG + Intronic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184267386 22:43356302-43356324 CTAGAGGAAGAAAAGAAGGAAGG - Intergenic
1184592173 22:45492294-45492316 TTCAAAGCAGAGTAGAAGTATGG + Intergenic
1184687596 22:46103675-46103697 CACCAGGCAGATAAGCAGGACGG + Intronic
1184835699 22:47019781-47019803 GTTAAGGCAGAGGGGAAGGATGG - Intronic
1184835763 22:47020009-47020031 ATCAAGGCAGCGGGGAAGGATGG - Intronic
1184848055 22:47101316-47101338 CCCAAACCAGAGAAGAAGCAGGG + Intronic
1184950299 22:47837222-47837244 CTACAGGAAGAGAAGAAGGCAGG - Intergenic
1184956793 22:47893138-47893160 CTCGAGGCAGAGAAGCATTATGG + Intergenic
1184959387 22:47917978-47918000 CTGAAGGAAGAAGAGAAGGAAGG - Intergenic
1185020830 22:48373949-48373971 AACAAGGCAGAGAAGAGGGGAGG - Intergenic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
949416013 3:3814693-3814715 CACATGGCAGAGGAGATGGAAGG - Intronic
949716558 3:6938616-6938638 CTTAAGGCAGTGAAGAAAGGAGG + Intronic
949739356 3:7212587-7212609 ATACAGGAAGAGAAGAAGGAAGG + Intronic
949940652 3:9151785-9151807 CTCAAGGGAGAGCCGAAGTAAGG + Intronic
950038850 3:9906683-9906705 CTAAAGGCAGAGAACAAGGTTGG - Intronic
950126194 3:10511171-10511193 CTCCAGGCAGAGAAGTGGAAAGG - Intronic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
950841237 3:15970184-15970206 CCCAAGGCGAAGAGGAAGGATGG - Intergenic
950936851 3:16847906-16847928 CAAAAGGAAGAGAAGAAGCAGGG + Intronic
950960587 3:17101681-17101703 CAAAAGGAAGACAAGAAGGAAGG + Intergenic
951272020 3:20637493-20637515 CTAAAGGCAGGGAAGATAGATGG - Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
951972986 3:28469280-28469302 TAAAAGGAAGAGAAGAAGGAAGG + Intronic
951979122 3:28546377-28546399 CACATGGCAGAAAAGATGGAAGG - Intergenic
952307608 3:32160048-32160070 GTCAAGTCAGAAAAGAAGGAAGG + Intronic
952720699 3:36529757-36529779 CTGCAGTCAGAGAAGAAGGCAGG - Intronic
952768561 3:36976699-36976721 CTCTCGGCTGAGAAGAAAGAGGG - Intergenic
953624687 3:44561222-44561244 CAGAAGGCAAAGAGGAAGGAAGG + Intronic
953901528 3:46846503-46846525 CTGAGGGCAGAGGACAAGGAGGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954289148 3:49640016-49640038 CTCAAGGCAGAGAGCAGGGCTGG + Intronic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954326082 3:49864811-49864833 CTCAAGGTAGTGGAGAAGGGAGG + Intronic
954707728 3:52489928-52489950 TTCAAGGCAGAGAGGAAGAGAGG - Intronic
955031302 3:55222554-55222576 ATCATGGCAGGGAAGAAGGAAGG + Intergenic
955396002 3:58557938-58557960 CTCTAGGCAGATAAGGGGGAGGG + Intergenic
955562195 3:60203905-60203927 GTGAAGACAGAGTAGAAGGATGG + Intronic
955711065 3:61779530-61779552 CTCCAGTCAGTGAAGATGGAGGG + Intronic
956368238 3:68529689-68529711 CACATGGCAGAGAGGAAGCAAGG + Intronic
956443903 3:69307288-69307310 CTCAGGGCAGACAACAAGAAGGG + Intronic
956643040 3:71432464-71432486 CCAAAGGGAGAGAAGAATGAGGG - Intronic
956718678 3:72099767-72099789 CCCAAGGCAAAGCAGAAGGCTGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956821095 3:72954918-72954940 CTCAAGTCAAAGGAGAAGGAAGG + Intronic
957193374 3:77039184-77039206 CACAAGGGGGAGAAAAAGGAGGG - Intronic
958732570 3:97974487-97974509 CTAAAGGAAGGAAAGAAGGAAGG + Intergenic
958907752 3:99960641-99960663 CTCAAGGTAGGGGAGAAGTAGGG + Intronic
959197520 3:103203560-103203582 CTATATGCAGTGAAGAAGGAAGG + Intergenic
959345450 3:105189032-105189054 CACAAGGCAGAGAAAAATGTAGG - Intergenic
959909241 3:111745039-111745061 CTCATAACAGAGAAGAAAGAAGG + Intronic
960500737 3:118435315-118435337 TTCAAGATAGTGAAGAAGGAAGG - Intergenic
960750312 3:120943772-120943794 TCCAAGGCAGAAAAGATGGATGG - Intronic
960766247 3:121133800-121133822 CGCAAGGCAAAGAGGAAGCAAGG + Intronic
960825586 3:121780201-121780223 CTCAAGGAAGAGAACAGAGAAGG - Intronic
961125910 3:124417371-124417393 TTCATGGGAGAGAAGAAGTATGG - Intronic
961374041 3:126450633-126450655 CTCCAGGGAGAGCAGCAGGAAGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
963662483 3:148144589-148144611 CTAAAGGCAGAGCTGAAAGATGG + Intergenic
963953310 3:151226241-151226263 AGCTAGGCAAAGAAGAAGGAAGG + Intronic
964230922 3:154466613-154466635 CTCAAGGCAGGAAAGCAGAAGGG - Intergenic
964514531 3:157493518-157493540 CTCATGGAACAGAAGAAGAATGG - Intronic
964557175 3:157952473-157952495 CTCAAGGAAGAAGAGAAAGAAGG - Intergenic
964592081 3:158376168-158376190 CGAAAGGAAGGGAAGAAGGAAGG - Intronic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
966023550 3:175246532-175246554 CTCAAGGTGGAGAAGAAACATGG + Intronic
966187378 3:177240250-177240272 CTCGAGGGAGAGAGGAATGAAGG - Intergenic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
966732899 3:183165166-183165188 CTCAAGGCAGACAAGATTTATGG - Intergenic
967268536 3:187713759-187713781 TGCAAGGCAGAAAAGCAGGAGGG + Intronic
967401585 3:189068773-189068795 CTCAAAAAAGAGAAAAAGGAAGG + Intronic
967891897 3:194369619-194369641 CTCTAAGCAGAGAGGAGGGATGG + Intronic
967892669 3:194374105-194374127 CTGAAGGGAGAGCAGATGGAGGG - Intergenic
969155008 4:5202533-5202555 ATCAATGCAGAGAAGAAACATGG - Intronic
969211047 4:5687515-5687537 CTCCAAGCAGGGAAGCAGGAAGG + Intronic
969301603 4:6300438-6300460 CTCCAGGCCCAGAAGAGGGAGGG + Intronic
969483936 4:7461310-7461332 ATAAAGGCAGAGGGGAAGGAGGG - Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969590183 4:8117603-8117625 GGCAAGGCTGAGAGGAAGGAAGG - Intronic
970580685 4:17471579-17471601 CTCTGGGGAGTGAAGAAGGAGGG + Intronic
971811356 4:31432304-31432326 CTCAAGTAAGATAAGAAGGCTGG - Intergenic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
973830612 4:54755547-54755569 CCAGAGGCAGAGAAGAAGGGAGG - Intergenic
973862139 4:55076328-55076350 ATCAAGGGAGAGAAGGAGGGAGG + Intergenic
974522187 4:62996062-62996084 AGGAAGGGAGAGAAGAAGGAAGG + Intergenic
974853833 4:67435361-67435383 GTGAAGGAAGAGAAGAGGGAGGG - Intergenic
975590721 4:75997022-75997044 CTCAAAGAAAAAAAGAAGGAAGG - Intergenic
976599920 4:86928516-86928538 CTGAAGGCAGAGTAGAGGAAGGG + Intronic
976909260 4:90280327-90280349 AGGAAGGGAGAGAAGAAGGAAGG - Intronic
977651194 4:99471509-99471531 CTCAAGGCACAAAAGAAAGGGGG - Intergenic
978265578 4:106820526-106820548 CTCAAGGAAGATAAAAAGGTAGG - Intergenic
978362041 4:107940780-107940802 CTAAAGGAAGATGAGAAGGAAGG + Intronic
979710355 4:123772082-123772104 ATGAAGGAAGAAAAGAAGGAAGG - Intergenic
980080745 4:128341336-128341358 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
980827500 4:138090060-138090082 CTAAAGGGAGCGAAGAAGAAAGG + Intergenic
981657211 4:147125205-147125227 CCCAGGTCAGGGAAGAAGGATGG + Intergenic
982557672 4:156889156-156889178 ATCATGGCTGAGAAGAAGGTAGG - Intronic
982884910 4:160766395-160766417 AGCAAGGAAGGGAAGAAGGAAGG + Intergenic
983030060 4:162789112-162789134 ATCAAGTAAGAAAAGAAGGAAGG + Intergenic
983216680 4:165008421-165008443 CTCAGGGCAGTGAAGCAGGAAGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
983800635 4:171925081-171925103 AACAAGGCAGAGAAGAATGCTGG + Intronic
984163842 4:176285197-176285219 CTCATGGCAGAGAAGAGAGGAGG + Intergenic
984550490 4:181153485-181153507 CTCAGGGGAGAGATGAAGAAAGG - Intergenic
985351387 4:189066590-189066612 CTCAAGGCTGCTAAGAAGGACGG - Intergenic
985509904 5:307552-307574 CTCAGGGCTGAGAGGAAGCAGGG + Intronic
985550350 5:529992-530014 ATAAAGGCAAAGCAGAAGGAAGG - Intergenic
986009667 5:3700806-3700828 GAGAAGGAAGAGAAGAAGGAGGG - Intergenic
986009704 5:3701016-3701038 GACAAGGAGGAGAAGAAGGAGGG - Intergenic
986221225 5:5770628-5770650 AGTAAGGCAGAGAAGCAGGAGGG + Intergenic
986510022 5:8494789-8494811 CTGAAGGCAGACAATAATGATGG + Intergenic
986759794 5:10869479-10869501 TTCAAGGTAGAGAGGAAGGAAGG - Intergenic
987037200 5:14030596-14030618 CCCAAATCAGAGCAGAAGGAAGG - Intergenic
987248026 5:16069342-16069364 TTCATGGTAGTGAAGAAGGAAGG + Intronic
987289424 5:16494584-16494606 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
987379871 5:17275406-17275428 GGCAAGGCCGAGGAGAAGGAGGG + Exonic
987893500 5:23914658-23914680 CCCAAGGCTGAGAACAACGATGG - Intergenic
988013245 5:25518028-25518050 CACAAGGGAGAGAACATGGAAGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988252628 5:28780094-28780116 GAAAAGACAGAGAAGAAGGAAGG - Intergenic
989145935 5:38250250-38250272 TTCAAGCCAGAGGAGAAGGTGGG - Intergenic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989458378 5:41668278-41668300 CACATGGCAGAAAAGATGGAAGG + Intergenic
990523339 5:56601090-56601112 TGAAAGGCAGAGAAGAATGAGGG - Intronic
992026182 5:72671431-72671453 CTCTAGGCAGAGCAGAAGTCTGG + Intergenic
992168567 5:74078769-74078791 CTCAAGGCAGAGAAACTGGGTGG - Intergenic
993277739 5:85883226-85883248 CTCAAGGCAGGGGAGTGGGAGGG - Intergenic
993338667 5:86693816-86693838 CTCATTGCAGGGAAGCAGGATGG - Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
993551423 5:89278433-89278455 CTCATGGCAGAAAAGAAAGAGGG - Intergenic
994097168 5:95857678-95857700 CTAATGGCAGGGAAGCAGGAGGG + Intronic
995217836 5:109615384-109615406 CAAAAGCCAGAGAAGAATGAGGG - Intergenic
995500143 5:112795458-112795480 CTCCAGGAAGAGAAGGAGGCTGG - Intronic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
998062115 5:139126956-139126978 ATCAAGGGAGAGGAGAGGGAGGG + Intronic
999524128 5:152383939-152383961 AAGAAGGAAGAGAAGAAGGAAGG - Intergenic
999696607 5:154192657-154192679 CTCAAGACAGAAAAAAAGAAGGG - Intronic
999803927 5:155064499-155064521 CTAAAGGAAGAGGAGAAGGGTGG - Intergenic
999875719 5:155803570-155803592 CTCTAAGCAGAGAAGAGAGAGGG + Intergenic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000440703 5:161259736-161259758 GTCAGGGCAGAGGAGAAAGAAGG - Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1001001339 5:168010037-168010059 CTCATGGCAGGGAAGCAGGAGGG - Intronic
1001004739 5:168040133-168040155 CTCATGGCAGACACAAAGGAGGG + Intronic
1001277256 5:170359837-170359859 TAGAAGGCAGAGAAGAAGGAGGG + Intronic
1001884276 5:175274737-175274759 CACAAGGCAGAAGAGATGGAAGG - Intergenic
1002103019 5:176866633-176866655 CCCAAGGCAGAGAGGATGAAGGG + Intronic
1002177415 5:177409105-177409127 TACAAGGGAGAGAAGAAGGCAGG + Intronic
1002353291 5:178601077-178601099 CTCAAAGAAGAGGGGAAGGAAGG + Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003014289 6:2455632-2455654 CCCAAGGAAGAGACAAAGGATGG - Intergenic
1003578708 6:7320164-7320186 TGCCAAGCAGAGAAGAAGGAGGG - Intronic
1004000742 6:11594642-11594664 CTCAAAGCAGAGACGAGGGGAGG + Intergenic
1004330244 6:14714504-14714526 GTCAGGGAAGAAAAGAAGGAAGG - Intergenic
1005473367 6:26183853-26183875 ACCAAGGCGCAGAAGAAGGACGG + Exonic
1005475051 6:26199616-26199638 ACCAAGGCGCAGAAGAAGGATGG + Exonic
1005476880 6:26216564-26216586 ACCAAGGCGCAGAAGAAGGATGG - Exonic
1005480603 6:26251708-26251730 ACCAAGGCGCAGAAGAAGGATGG + Exonic
1005483061 6:26273033-26273055 ACCAAGGCACAGAAGAAGGATGG + Exonic
1005642295 6:27807827-27807849 ACCAAGGCCCAGAAGAAGGATGG - Exonic
1005643047 6:27815101-27815123 AACAAGGCTCAGAAGAAGGATGG + Exonic
1005845986 6:29779041-29779063 GTCAAGGTAGAGAGGAGGGAGGG - Intergenic
1006110515 6:31741897-31741919 CACATGGCAGAGAAGAAGCAAGG + Intronic
1006116957 6:31780630-31780652 CTCAGGGTGGAGAAGAGGGATGG + Intronic
1006471239 6:34230063-34230085 CTCAAGGCAAAGAAGAGGTCAGG - Intergenic
1006477179 6:34263929-34263951 CTCAAGGAAGTGAAGATGGGAGG - Intergenic
1006783313 6:36647516-36647538 CTCAAGAGAGGGAAAAAGGAAGG + Intergenic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1007089218 6:39171882-39171904 CTCAAGGCAGAGAAGAAGCTTGG - Intergenic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1007972288 6:46064726-46064748 ATGAAGGAAGAGAAGAAGGGAGG + Intronic
1008055948 6:46946221-46946243 TTGCAGCCAGAGAAGAAGGAGGG + Intronic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1009604731 6:65852340-65852362 ATTAAGTCAGAGAAGATGGAAGG - Intergenic
1010017352 6:71120971-71120993 CTTAAGAGAGAGAAGAAGGCCGG - Intergenic
1011406859 6:87024719-87024741 CTGCAGGCAGAGAATAAGGGTGG - Intergenic
1011572322 6:88752014-88752036 CTCAAGGGAGAGAATATGGGGGG - Intronic
1011811882 6:91141653-91141675 TTCCAGGAAGAGAAGGAGGAAGG - Intergenic
1011855724 6:91688411-91688433 AGGAAGGCAGAGAGGAAGGAAGG - Intergenic
1012447302 6:99319674-99319696 CTCAAGTCAATGAAGAACGAAGG + Intronic
1012797828 6:103785718-103785740 CTGAAGGCAAAGGAGAAGCAAGG + Intergenic
1013524572 6:110962469-110962491 CTCCTGACAGAGAAGAAGGAAGG + Exonic
1013804877 6:113986024-113986046 CCAGTGGCAGAGAAGAAGGAGGG + Intronic
1013812406 6:114059688-114059710 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
1013968355 6:115983734-115983756 CTCTAGGCAGAGAAACAGCAAGG - Intronic
1014251146 6:119116740-119116762 CTCAAAGCAGAGAAGGATTAAGG + Intronic
1014397844 6:120948504-120948526 CTCAAGGTGGAGTAGGAGGAGGG - Intergenic
1016123966 6:140376423-140376445 AACAAGGGAGAGAAGAAGGAAGG - Intergenic
1016532592 6:145075106-145075128 GGGAAGGAAGAGAAGAAGGAAGG + Intergenic
1016696629 6:147003793-147003815 CTAAAGGCAGGAAACAAGGAAGG + Intergenic
1017036908 6:150275151-150275173 CTCAAGGCAGTAAAGAAGGCAGG + Intergenic
1017306345 6:152922659-152922681 CTCAAGGGAGGGAAGCATGATGG + Intergenic
1017332609 6:153217302-153217324 CTCAAAGCAGAGGAGTAGGTAGG - Intergenic
1017601046 6:156081550-156081572 GGCAAAGCAGAGAAGAAGTAGGG + Intergenic
1017751807 6:157495629-157495651 ATAAAGGCAGAGCAGGAGGATGG + Intronic
1017879336 6:158548883-158548905 CCCAAGGCAGAGAAGGTGAAGGG + Intronic
1018489032 6:164272768-164272790 CTCAAGGCCCAGAGGAAGCAAGG - Intergenic
1018668289 6:166159565-166159587 CTCAAGGCATAAAATGAGGAAGG + Intronic
1018857276 6:167683720-167683742 CCCAAGGCAGAGATGAAGAATGG - Intergenic
1019726100 7:2603464-2603486 CGCCAGGGAGAGAAGCAGGATGG - Intronic
1020417891 7:7967719-7967741 CACAAGGAAGAAAAGAAGGATGG + Intronic
1020572261 7:9879195-9879217 AGCAAGGAAGAGACGAAGGAAGG + Intergenic
1020799665 7:12718113-12718135 CTCAAAAAAAAGAAGAAGGAAGG - Intergenic
1021090841 7:16480858-16480880 CTCCAGTCAGAGATGAAAGAGGG + Intronic
1021465273 7:20935948-20935970 CTCATGGAAGAAAAAAAGGATGG - Intergenic
1022019742 7:26386839-26386861 CTGATGGCAGAGAAAAAGAAGGG + Intergenic
1022093752 7:27125056-27125078 GTACAGCCAGAGAAGAAGGATGG - Intronic
1022337359 7:29434278-29434300 CTCATGGCAGAGAACATGGTGGG - Intronic
1022514639 7:30967673-30967695 AGGAAGGCAGAAAAGAAGGAAGG - Intronic
1023484166 7:40666345-40666367 CTCAAGAAAGAAAGGAAGGAAGG + Intronic
1023544686 7:41305893-41305915 CTCAAGATATAGAAAAAGGAGGG - Intergenic
1023805967 7:43873194-43873216 CTCAAGAAAGAGAAGACCGAGGG + Intronic
1024140129 7:46454662-46454684 TAGAAGGCAGAGAAGAAAGAAGG - Intergenic
1025162641 7:56676873-56676895 CTCATGGCAGAGAAAAAAGAAGG - Intergenic
1025267924 7:57481601-57481623 CTCATGGCAGAGAAAAAAGAAGG + Intergenic
1026244808 7:68610550-68610572 CCCAAGGCTGAGAATAATGAAGG - Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1028838180 7:95397034-95397056 CTCAAGACCTAGAAGAAAGAGGG - Intergenic
1029611508 7:101628991-101629013 CCCAAGGCAGATAAGAAGTGGGG + Intronic
1029839459 7:103346647-103346669 CTAAAGACAAAGTAGAAGGATGG - Intronic
1030008698 7:105143941-105143963 CTCAAGCCAGGGAAGAACTATGG + Intronic
1030268187 7:107642534-107642556 CACCAGGCAGAGGAAAAGGAAGG + Intergenic
1030515986 7:110538361-110538383 CTTAACACAGAGAACAAGGAAGG - Intergenic
1030613443 7:111713482-111713504 CTAAAGGCAGAGAAGCAGAGAGG - Intergenic
1031467708 7:122133853-122133875 CACAAGGTAGAGAAGAGGGAAGG + Intronic
1031795047 7:126162593-126162615 AGCAAAGAAGAGAAGAAGGATGG + Intergenic
1032939404 7:136771298-136771320 CAAAAGGAAGACAAGAAGGAAGG + Intergenic
1032948719 7:136882446-136882468 TTAAATGCTGAGAAGAAGGAGGG - Intronic
1033218631 7:139512824-139512846 CTCAAGGCAGAGACCAAGATGGG + Intergenic
1033319874 7:140329864-140329886 CTAAAGGCACAGAAGAGGCAAGG + Intronic
1033600634 7:142886018-142886040 CTCTAGGCAGTGAGAAAGGAGGG + Intergenic
1035597352 8:869090-869112 CTCGAGGAGGAGAGGAAGGAAGG - Intergenic
1036290081 8:7479979-7480001 CTCAAGGCAAAGGAGGAGCAAGG - Intergenic
1036331395 8:7831544-7831566 CTCAAGGCAAAGGAGGAGCAAGG + Intergenic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1036788499 8:11703124-11703146 CTCAAGCCAGATTAGAGGGATGG - Intronic
1036994022 8:13633309-13633331 CGGAAGGCAAAGGAGAAGGAAGG - Intergenic
1037666847 8:20977110-20977132 GTCAAAGCAGAGAAGAAGTCAGG + Intergenic
1037737604 8:21580017-21580039 CTCCAGGGAGAGGAAAAGGAAGG - Intergenic
1038462333 8:27727780-27727802 CTCAAAGCAGAGAGCAAGAAGGG + Intergenic
1038710556 8:29940593-29940615 CCCAAGGCAGGGAAGGGGGATGG + Intergenic
1038922185 8:32097002-32097024 CTGAAGGCAGGGAAGGATGAGGG - Intronic
1038964664 8:32558464-32558486 CTCAGGGCAGAGCAGCAGGATGG - Intronic
1039362526 8:36893960-36893982 GTCAAGTTAGAGATGAAGGAAGG - Intronic
1039538894 8:38345245-38345267 AAGAAGGGAGAGAAGAAGGAAGG + Intronic
1040532936 8:48280526-48280548 CTCCAGCCAGAGGAAAAGGATGG - Intergenic
1041301278 8:56414438-56414460 CCGAAGGCAGAGAGGAAAGATGG + Intergenic
1041315721 8:56560176-56560198 CACAGGGCTGAGAACAAGGAGGG + Intergenic
1042408861 8:68438894-68438916 CTCAAAAAAGAGCAGAAGGAAGG + Intronic
1043137572 8:76547667-76547689 CTAGAGGCAGAGGAGAAGGAAGG - Intergenic
1044478263 8:92654089-92654111 TTCAAGGCAGGGAAAAATGAAGG + Intergenic
1044548978 8:93491186-93491208 CTCCATGCAGAAAAGAGGGAGGG - Intergenic
1044704494 8:94995300-94995322 CTAAAGGCTGGGAGGAAGGAGGG + Intronic
1045207676 8:100059203-100059225 CTAAAGGGAGATAGGAAGGAAGG + Intronic
1045239134 8:100383422-100383444 TTCAAGGAAGAGGAGAAGAAGGG + Intronic
1045272550 8:100674414-100674436 CTCAAGGAAGGAAAGAAGGAAGG - Intergenic
1045546618 8:103134876-103134898 CACAAGGCAGAAGAGATGGAAGG - Intronic
1047401414 8:124551545-124551567 CTCAAGGCAGAGGAGGAGTTTGG - Intronic
1047881146 8:129194979-129195001 CTAAAAAGAGAGAAGAAGGAAGG - Intergenic
1048080490 8:131121322-131121344 CTTAAGACAGAGAAGCAGCAAGG + Intergenic
1048307374 8:133293660-133293682 GACAGGGGAGAGAAGAAGGAAGG - Intronic
1048358512 8:133674203-133674225 CTCAGGGCAGGGTAGAAGGGAGG - Intergenic
1048473630 8:134724286-134724308 GTCAAGGCATAGCAGAAGGAAGG + Intergenic
1050306221 9:4308386-4308408 GTCAAAGAAGAGGAGAAGGAAGG + Intronic
1051130064 9:13850852-13850874 GGGCAGGCAGAGAAGAAGGATGG - Intergenic
1051219104 9:14830048-14830070 CACAAGTCAGAGAAGAAAGTGGG + Intronic
1051229612 9:14942137-14942159 CTCAAGAGAAATAAGAAGGAGGG + Intergenic
1051249218 9:15142384-15142406 ATTAAGGCAAAGAAGAAAGAAGG + Intergenic
1052345696 9:27407567-27407589 CTCCAAGAAGAGAGGAAGGAAGG - Intronic
1052397617 9:27959364-27959386 CTTAAGTCAGTGAAGAAGAAAGG - Intronic
1052468841 9:28866572-28866594 CCCAGGGCAGAGAAGAAGGGTGG + Intergenic
1052476482 9:28967169-28967191 CTCAAGGCAGATAACAAACAAGG - Intergenic
1053516528 9:38735071-38735093 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1053730826 9:41055155-41055177 CTGAAGGAAGAAAGGAAGGAAGG + Intergenic
1054896020 9:70312244-70312266 CGGAAGGCAAAGAAGAAGTAAGG + Intronic
1055662361 9:78517767-78517789 TTGAAGGCAGAGGGGAAGGAAGG + Intergenic
1055775623 9:79764389-79764411 CCAGAGGCAGAGAATAAGGATGG - Intergenic
1056968782 9:91185779-91185801 CTTTAGGCAAAGAAGCAGGAAGG - Intergenic
1057222882 9:93267338-93267360 GTCATGACAGACAAGAAGGATGG - Intronic
1057565085 9:96160217-96160239 GGGAAGGGAGAGAAGAAGGAAGG + Intergenic
1057870170 9:98710726-98710748 CTCCAGGAAGGGAGGAAGGAAGG + Intergenic
1058254059 9:102738779-102738801 CTCAAAAGAGAGAACAAGGAAGG - Intergenic
1059437347 9:114284701-114284723 CTGCAGGCAAACAAGAAGGAGGG - Intronic
1059761685 9:117343939-117343961 GTAGAGGGAGAGAAGAAGGAAGG + Intronic
1060153272 9:121301996-121302018 CTCAAGGCAGGGAAGGAGCCTGG + Exonic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1060377576 9:123130895-123130917 CTGGAGGCAGGGAAGAAGAAAGG - Intronic
1061302028 9:129710892-129710914 GTGAAGACAGAAAAGAAGGAAGG - Intronic
1061372966 9:130208163-130208185 ATGTAGGCAGAGAAGAAAGATGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062024794 9:134335403-134335425 ATCAAGGCAGAGAGAATGGATGG + Intronic
1186217234 X:7313095-7313117 CTGTAGGCAGAGAAAAAGGGAGG - Intronic
1186240383 X:7559199-7559221 TGGAAGGAAGAGAAGAAGGAAGG - Intergenic
1186417257 X:9394479-9394501 CTCCAGGCAAAGGAGAAGAAAGG + Intergenic
1186881953 X:13875285-13875307 CTCCAGGCAGAGCTGAATGAGGG + Intronic
1186962611 X:14752935-14752957 CCAGAGACAGAGAAGAAGGAAGG - Intergenic
1187043540 X:15622664-15622686 TTTAAGGAAGAGAAGAAGAAAGG + Intergenic
1187178576 X:16919770-16919792 CAGAAGGCAGAGAGGAAAGATGG + Intergenic
1187685007 X:21807337-21807359 CACAAGGAAGAGAAGTGGGAGGG - Intergenic
1187926136 X:24252017-24252039 CTAAAGGGACAGCAGAAGGAGGG - Intergenic
1188515384 X:30980362-30980384 CCCAAGGCAGGCAGGAAGGAGGG - Intergenic
1188519397 X:31020981-31021003 CACATGGCAGAGAACAGGGAGGG - Intergenic
1188971534 X:36622847-36622869 CACAAGGCAGAAAAGATAGAAGG - Intergenic
1189656260 X:43248077-43248099 CACAAGGAAGAGAAGCATGAAGG + Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1191252992 X:58268225-58268247 CGCAAGGCAGAGGAGGAGGCTGG - Intergenic
1192927644 X:75772600-75772622 CTAAAGGAAGACAAGAAGGAAGG + Intergenic
1193017114 X:76747415-76747437 CTAAAGGAAGACAAGAATGAGGG + Intergenic
1193050791 X:77097097-77097119 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1193097443 X:77566065-77566087 CTAAAAGAAGAGGAGAAGGAAGG + Intronic
1193190653 X:78566219-78566241 CTCAGGGAAGAGTGGAAGGAGGG - Intergenic
1193397402 X:81001926-81001948 TTGAAGGCAGAGAAGGAAGAGGG - Intergenic
1195403910 X:104492184-104492206 CTACAGGCAGAGAAAAAGGGAGG - Intergenic
1195637224 X:107131956-107131978 CTTCTGACAGAGAAGAAGGAAGG + Intronic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1195870566 X:109481029-109481051 ATGAAGGGAGAGAAGAAGGAAGG + Intronic
1196122929 X:112069697-112069719 CTAAAGGCAGAGCAGAAGTCAGG - Intronic
1196457299 X:115899560-115899582 CTCAAGACAGAGGAAAAAGAAGG + Intergenic
1196722155 X:118864517-118864539 CTCAAAGCAAAGAAGCAGCAAGG + Intergenic
1196872627 X:120127198-120127220 CTCAAGACAGAGATCCAGGAAGG - Intergenic
1197012479 X:121583196-121583218 TGAAAGGCAGAGAAGAAGTAGGG + Intergenic
1197095532 X:122590166-122590188 CTCATGGCAGTGAAGATGCAGGG - Intergenic
1197816683 X:130505146-130505168 GGCAAGACAGAAAAGAAGGAGGG - Intergenic
1198151040 X:133910090-133910112 CTCAGAGAAGAGATGAAGGATGG - Intronic
1198190193 X:134296424-134296446 CTTAAGGAAGAGGGGAAGGAGGG + Intergenic
1198268923 X:135035771-135035793 CTTAAGGCAGAGATGTAGTAAGG + Intergenic
1198706677 X:139456598-139456620 TACAAGTAAGAGAAGAAGGAAGG - Intergenic
1199076742 X:143534196-143534218 CTCAAGGCAGAGGAGTGGAAGGG + Intergenic
1199160299 X:144601717-144601739 ATAAAGGCAGAGAAGAAGTAAGG - Intergenic
1199414584 X:147566493-147566515 CTCAAGGCAGAATAGAATGGTGG + Intergenic
1200065544 X:153502681-153502703 CTCAAGGCTCAAAAGAATGAGGG + Intronic
1200161640 X:154012819-154012841 CTGAAGGCTGGGAACAAGGAGGG - Intronic
1200797228 Y:7351960-7351982 CTGAAGGCAAAGGAGAAGCAAGG - Intergenic
1201550173 Y:15210726-15210748 TGCAAGGGAGAGAGGAAGGAAGG + Intergenic
1201550248 Y:15211119-15211141 TGCAAGGGAGAGAAGAAGGAAGG + Intergenic
1201550505 Y:15212398-15212420 TGCAAGGGAGAGAGGAAGGAAGG + Intergenic
1202196292 Y:22301134-22301156 CTGAAGGAAGGAAAGAAGGAAGG + Intergenic
1202323158 Y:23657720-23657742 CTCAAAGAAAAGAAGAAGCAAGG + Intergenic
1202547614 Y:26012334-26012356 CTCAAAGAAAAGAAGAAGCAAGG - Intergenic