ID: 1103921066

View in Genome Browser
Species Human (GRCh38)
Location 12:124399404-124399426
Sequence TTCTTCCTGCCTGATCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 430}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921066_1103921069 -7 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921066_1103921078 27 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921066_1103921070 -6 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921070 12:124399421-124399443 GAAGAAAGCCCTTTCACCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 147
1103921066_1103921077 20 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921066 Original CRISPR TTCTTCCTGCCTGATCTCTG GGG (reversed) Intronic