ID: 1103921069

View in Genome Browser
Species Human (GRCh38)
Location 12:124399420-124399442
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921063_1103921069 6 Left 1103921063 12:124399391-124399413 CCGAGAGGACTATCCCCAGAGAT 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921057_1103921069 27 Left 1103921057 12:124399370-124399392 CCCCCAGCATCAGCCTTGGGTCC 0: 1
1: 0
2: 1
3: 21
4: 262
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921067_1103921069 -8 Left 1103921067 12:124399405-124399427 CCCAGAGATCAGGCAGGAAGAAA 0: 1
1: 0
2: 9
3: 44
4: 420
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921066_1103921069 -7 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921059_1103921069 25 Left 1103921059 12:124399372-124399394 CCCAGCATCAGCCTTGGGTCCGA 0: 1
1: 0
2: 2
3: 5
4: 89
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921062_1103921069 14 Left 1103921062 12:124399383-124399405 CCTTGGGTCCGAGAGGACTATCC 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921068_1103921069 -9 Left 1103921068 12:124399406-124399428 CCAGAGATCAGGCAGGAAGAAAG 0: 1
1: 0
2: 2
3: 53
4: 467
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921060_1103921069 24 Left 1103921060 12:124399373-124399395 CCAGCATCAGCCTTGGGTCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184
1103921058_1103921069 26 Left 1103921058 12:124399371-124399393 CCCCAGCATCAGCCTTGGGTCCG 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1103921069 12:124399420-124399442 GGAAGAAAGCCCTTTCACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type