ID: 1103921072

View in Genome Browser
Species Human (GRCh38)
Location 12:124399430-124399452
Sequence ACTTGGAGGCCCAGGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 340}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921072_1103921077 -6 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1103921072_1103921078 1 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921072_1103921083 26 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921072_1103921082 15 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921072 Original CRISPR ACTTGGAGGCCCAGGGTGAA AGG (reversed) Intronic