ID: 1103921073

View in Genome Browser
Species Human (GRCh38)
Location 12:124399437-124399459
Sequence GCGGTGTACTTGGAGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921073_1103921078 -6 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921073_1103921083 19 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921073_1103921082 8 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921073_1103921084 27 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921073 Original CRISPR GCGGTGTACTTGGAGGCCCA GGG (reversed) Intronic