ID: 1103921074

View in Genome Browser
Species Human (GRCh38)
Location 12:124399438-124399460
Sequence GGCGGTGTACTTGGAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921074_1103921082 7 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921074_1103921078 -7 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921074_1103921084 26 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921074_1103921083 18 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921074 Original CRISPR GGCGGTGTACTTGGAGGCCC AGG (reversed) Intronic