ID: 1103921075

View in Genome Browser
Species Human (GRCh38)
Location 12:124399444-124399466
Sequence CTTGGTGGCGGTGTACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921075_1103921087 29 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921087 12:124399496-124399518 CATAGGCTCTGTGGCCAATGGGG 0: 1
1: 0
2: 1
3: 21
4: 161
1103921075_1103921084 20 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921075_1103921085 27 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921085 12:124399494-124399516 TGCATAGGCTCTGTGGCCAATGG 0: 1
1: 0
2: 1
3: 18
4: 169
1103921075_1103921086 28 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921086 12:124399495-124399517 GCATAGGCTCTGTGGCCAATGGG 0: 1
1: 0
2: 0
3: 19
4: 127
1103921075_1103921083 12 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921075_1103921082 1 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921075 Original CRISPR CTTGGTGGCGGTGTACTTGG AGG (reversed) Intronic