ID: 1103921077

View in Genome Browser
Species Human (GRCh38)
Location 12:124399447-124399469
Sequence CCAAGTACACCGCCACCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921068_1103921077 18 Left 1103921068 12:124399406-124399428 CCAGAGATCAGGCAGGAAGAAAG 0: 1
1: 0
2: 2
3: 53
4: 467
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1103921072_1103921077 -6 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1103921067_1103921077 19 Left 1103921067 12:124399405-124399427 CCCAGAGATCAGGCAGGAAGAAA 0: 1
1: 0
2: 9
3: 44
4: 420
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1103921071_1103921077 -5 Left 1103921071 12:124399429-124399451 CCCTTTCACCCTGGGCCTCCAAG 0: 1
1: 0
2: 4
3: 101
4: 1117
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1103921066_1103921077 20 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921077 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921077 Original CRISPR CCAAGTACACCGCCACCAAG AGG Intronic