ID: 1103921078

View in Genome Browser
Species Human (GRCh38)
Location 12:124399454-124399476
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921071_1103921078 2 Left 1103921071 12:124399429-124399451 CCCTTTCACCCTGGGCCTCCAAG 0: 1
1: 0
2: 4
3: 101
4: 1117
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921066_1103921078 27 Left 1103921066 12:124399404-124399426 CCCCAGAGATCAGGCAGGAAGAA 0: 1
1: 0
2: 4
3: 33
4: 430
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921067_1103921078 26 Left 1103921067 12:124399405-124399427 CCCAGAGATCAGGCAGGAAGAAA 0: 1
1: 0
2: 9
3: 44
4: 420
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921072_1103921078 1 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921073_1103921078 -6 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921068_1103921078 25 Left 1103921068 12:124399406-124399428 CCAGAGATCAGGCAGGAAGAAAG 0: 1
1: 0
2: 2
3: 53
4: 467
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161
1103921074_1103921078 -7 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921078 12:124399454-124399476 CACCGCCACCAAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type