ID: 1103921080

View in Genome Browser
Species Human (GRCh38)
Location 12:124399459-124399481
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921080_1103921086 13 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921086 12:124399495-124399517 GCATAGGCTCTGTGGCCAATGGG 0: 1
1: 0
2: 0
3: 19
4: 127
1103921080_1103921084 5 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921080_1103921083 -3 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921080_1103921087 14 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921087 12:124399496-124399518 CATAGGCTCTGTGGCCAATGGGG 0: 1
1: 0
2: 1
3: 21
4: 161
1103921080_1103921085 12 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921085 12:124399494-124399516 TGCATAGGCTCTGTGGCCAATGG 0: 1
1: 0
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921080 Original CRISPR ATTTTCCAGCTGCCTCTTGG TGG (reversed) Intronic