ID: 1103921081

View in Genome Browser
Species Human (GRCh38)
Location 12:124399462-124399484
Sequence GATATTTTCCAGCTGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921081_1103921083 -6 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921081_1103921086 10 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921086 12:124399495-124399517 GCATAGGCTCTGTGGCCAATGGG 0: 1
1: 0
2: 0
3: 19
4: 127
1103921081_1103921084 2 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921081_1103921085 9 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921085 12:124399494-124399516 TGCATAGGCTCTGTGGCCAATGG 0: 1
1: 0
2: 1
3: 18
4: 169
1103921081_1103921087 11 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921087 12:124399496-124399518 CATAGGCTCTGTGGCCAATGGGG 0: 1
1: 0
2: 1
3: 21
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921081 Original CRISPR GATATTTTCCAGCTGCCTCT TGG (reversed) Intronic