ID: 1103921082

View in Genome Browser
Species Human (GRCh38)
Location 12:124399468-124399490
Sequence GGCAGCTGGAAAATATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921076_1103921082 -2 Left 1103921076 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921073_1103921082 8 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921074_1103921082 7 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921072_1103921082 15 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921075_1103921082 1 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183
1103921071_1103921082 16 Left 1103921071 12:124399429-124399451 CCCTTTCACCCTGGGCCTCCAAG 0: 1
1: 0
2: 4
3: 101
4: 1117
Right 1103921082 12:124399468-124399490 GGCAGCTGGAAAATATCTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921082 Original CRISPR GGCAGCTGGAAAATATCTGC AGG Intronic