ID: 1103921083

View in Genome Browser
Species Human (GRCh38)
Location 12:124399479-124399501
Sequence AATATCTGCAGGAGCTGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921080_1103921083 -3 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921074_1103921083 18 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921075_1103921083 12 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921073_1103921083 19 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921076_1103921083 9 Left 1103921076 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921079_1103921083 0 Left 1103921079 12:124399456-124399478 CCGCCACCAAGAGGCAGCTGGAA 0: 1
1: 0
2: 5
3: 36
4: 270
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921081_1103921083 -6 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921071_1103921083 27 Left 1103921071 12:124399429-124399451 CCCTTTCACCCTGGGCCTCCAAG 0: 1
1: 0
2: 4
3: 101
4: 1117
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137
1103921072_1103921083 26 Left 1103921072 12:124399430-124399452 CCTTTCACCCTGGGCCTCCAAGT 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1103921083 12:124399479-124399501 AATATCTGCAGGAGCTGCATAGG 0: 1
1: 0
2: 1
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921083 Original CRISPR AATATCTGCAGGAGCTGCAT AGG Intronic