ID: 1103921084

View in Genome Browser
Species Human (GRCh38)
Location 12:124399487-124399509
Sequence CAGGAGCTGCATAGGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 484}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103921074_1103921084 26 Left 1103921074 12:124399438-124399460 CCTGGGCCTCCAAGTACACCGCC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921076_1103921084 17 Left 1103921076 12:124399447-124399469 CCAAGTACACCGCCACCAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921073_1103921084 27 Left 1103921073 12:124399437-124399459 CCCTGGGCCTCCAAGTACACCGC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921081_1103921084 2 Left 1103921081 12:124399462-124399484 CCAAGAGGCAGCTGGAAAATATC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921079_1103921084 8 Left 1103921079 12:124399456-124399478 CCGCCACCAAGAGGCAGCTGGAA 0: 1
1: 0
2: 5
3: 36
4: 270
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921075_1103921084 20 Left 1103921075 12:124399444-124399466 CCTCCAAGTACACCGCCACCAAG 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484
1103921080_1103921084 5 Left 1103921080 12:124399459-124399481 CCACCAAGAGGCAGCTGGAAAAT 0: 1
1: 1
2: 3
3: 26
4: 238
Right 1103921084 12:124399487-124399509 CAGGAGCTGCATAGGCTCTGTGG 0: 1
1: 0
2: 4
3: 39
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103921084 Original CRISPR CAGGAGCTGCATAGGCTCTG TGG Intronic