ID: 1103922138

View in Genome Browser
Species Human (GRCh38)
Location 12:124404557-124404579
Sequence GCTGCATTTACTGGCCATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103922138_1103922140 -8 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922140 12:124404572-124404594 AATGCAGCTCCACACCCATCAGG 0: 1
1: 0
2: 1
3: 9
4: 187
1103922138_1103922141 -1 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922141 12:124404579-124404601 CTCCACACCCATCAGGCCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 130
1103922138_1103922145 5 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922145 12:124404585-124404607 ACCCATCAGGCCGCAGGCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 241
1103922138_1103922154 30 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922154 12:124404610-124404632 AGTTGGGAGAGGGATGCATCTGG 0: 1
1: 0
2: 0
3: 26
4: 268
1103922138_1103922143 3 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922143 12:124404583-124404605 ACACCCATCAGGCCGCAGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 131
1103922138_1103922152 20 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922152 12:124404600-124404622 GGCAGGGGCCAGTTGGGAGAGGG 0: 1
1: 0
2: 4
3: 82
4: 661
1103922138_1103922144 4 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922144 12:124404584-124404606 CACCCATCAGGCCGCAGGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 174
1103922138_1103922148 13 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922148 12:124404593-124404615 GGCCGCAGGCAGGGGCCAGTTGG 0: 1
1: 0
2: 0
3: 35
4: 337
1103922138_1103922149 14 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922149 12:124404594-124404616 GCCGCAGGCAGGGGCCAGTTGGG 0: 1
1: 0
2: 1
3: 11
4: 194
1103922138_1103922151 19 Left 1103922138 12:124404557-124404579 CCGGCATGGCCAGTAAATGCAGC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1103922151 12:124404599-124404621 AGGCAGGGGCCAGTTGGGAGAGG 0: 1
1: 0
2: 7
3: 80
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103922138 Original CRISPR GCTGCATTTACTGGCCATGC CGG (reversed) Intronic
900076344 1:820819-820841 GATGCATCTACTGGCCAGGCAGG - Intergenic
902235716 1:15056132-15056154 GCGGCATTCCCTCGCCATGCCGG + Exonic
902849220 1:19140682-19140704 GCTGCTTTGACAGGCCATTCTGG - Intronic
904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG + Intergenic
904384649 1:30133322-30133344 GCTGCCTGTACTGGCCATGCTGG - Intergenic
906795856 1:48695937-48695959 GCTGAACTCCCTGGCCATGCAGG - Intronic
908021512 1:59903145-59903167 GCTGCTTTTCCTGGCTCTGCAGG + Intronic
909215232 1:72878301-72878323 CCTGCTTTTTCTAGCCATGCTGG - Intergenic
909811256 1:79933904-79933926 GCTTTATATCCTGGCCATGCTGG - Intergenic
912236528 1:107857189-107857211 GCTTTATATCCTGGCCATGCTGG - Intronic
912411249 1:109482114-109482136 GCTGCAAGTACTTGCCATGAAGG + Exonic
914804604 1:150983040-150983062 GCTGAATTTCCTGGCCCTTCAGG - Intronic
918931791 1:190864251-190864273 GCTGCATGTTCTGGGCAGGCGGG + Intergenic
919915178 1:202134548-202134570 CCTGCAAGTACTGGCCGTGCTGG + Intronic
920249323 1:204612801-204612823 GGTGCATTTAGTGTCCATCCTGG + Intergenic
923272049 1:232364570-232364592 GCAGCATTTACTTGTCATGGAGG - Intergenic
923715543 1:236422018-236422040 ACTGCCTTTACTGGCCATCAGGG - Intronic
1064580088 10:16785168-16785190 GCTTTATATCCTGGCCATGCTGG - Intronic
1065221839 10:23503855-23503877 TATGTATTTACTGGCCATTCAGG + Intergenic
1066417571 10:35235567-35235589 GCAGGATTTCCTGGCCATTCTGG - Intergenic
1066512413 10:36116432-36116454 GCTCCAATTACAGGACATGCAGG + Intergenic
1068947812 10:62746991-62747013 TCTGCATTCACTGCCCATCCTGG + Intergenic
1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG + Intergenic
1074602690 10:114931337-114931359 CCTGCTTTTTCTAGCCATGCTGG - Intergenic
1075014953 10:118903796-118903818 GCTGCCCTTCCAGGCCATGCTGG - Intergenic
1075543257 10:123333872-123333894 GGAGCATTCTCTGGCCATGCAGG + Intergenic
1075939491 10:126377481-126377503 GCTTTATGTTCTGGCCATGCTGG + Intronic
1077089741 11:773023-773045 GCTGCCTGTCCAGGCCATGCTGG + Intronic
1079607864 11:22392240-22392262 CCTGCTTTTTCTAGCCATGCTGG - Intergenic
1081057204 11:38424733-38424755 ACTGCTTTTTCTAGCCATGCTGG - Intergenic
1082006792 11:47423757-47423779 TTTGCTTTTACTGCCCATGCTGG - Intronic
1082777851 11:57261386-57261408 GCTGAAATGACTGGCCATGGAGG - Intergenic
1082997173 11:59263538-59263560 GCTGCACTGCCTGGCCATGGTGG - Intergenic
1083157335 11:60832231-60832253 GCTGCATCCACTGGCCAGTCTGG - Intergenic
1083343281 11:61972590-61972612 ACTGTATTTAATGGCCATGCGGG - Intergenic
1086141825 11:83508007-83508029 GCTTTATATACTAGCCATGCTGG + Intronic
1094497190 12:30995667-30995689 TCTTGATATACTGGCCATGCTGG + Exonic
1094762966 12:33556541-33556563 GCTTTATATCCTGGCCATGCTGG - Intergenic
1097366683 12:58722486-58722508 CCTGCTTTTTCTAGCCATGCTGG + Intronic
1099174248 12:79402287-79402309 GCAGCACTTACTGGCCACGTGGG - Intronic
1101709494 12:107251619-107251641 TCTGCTTTTTCTAGCCATGCTGG + Intergenic
1103922138 12:124404557-124404579 GCTGCATTTACTGGCCATGCCGG - Intronic
1104249316 12:127076005-127076027 GCTGTATTTACTTCCCATGCTGG - Intergenic
1104286392 12:127428545-127428567 GCAGCATTCATTGCCCATGCAGG - Intergenic
1104531878 12:129579681-129579703 CCTGCTTTTTCTAGCCATGCTGG + Intronic
1105719592 13:23100744-23100766 CCTGTATTTGCTGGCCATGCTGG - Intergenic
1107235319 13:38161540-38161562 GTTTTATATACTGGCCATGCTGG - Intergenic
1109859039 13:68172760-68172782 GCTACATCTGCTGTCCATGCAGG + Intergenic
1110759317 13:79213497-79213519 GCTGGAATTACAGGCCATGTTGG + Intergenic
1111935506 13:94553180-94553202 GCTCCATTTATTGCCCAGGCTGG + Intergenic
1111958760 13:94786177-94786199 GCTTTATATTCTGGCCATGCTGG - Intergenic
1112938105 13:104825952-104825974 GCAGCCTTCTCTGGCCATGCAGG - Intergenic
1120174003 14:81274397-81274419 GCTGCATTTACTTGCCCTTGAGG + Intronic
1120231863 14:81848898-81848920 CCTGCTTTTTCTAGCCATGCTGG + Intergenic
1122954189 14:105062202-105062224 GCTGCATCTCCTGTCCCTGCTGG + Intronic
1202894655 14_GL000194v1_random:24-46 GCAGCATTTGCTGGACATGAGGG - Intergenic
1125748479 15:42013043-42013065 GCTGCATTTCCAGGCCACGGGGG - Intronic
1127092987 15:55484864-55484886 GCTTTATATACTAGCCATGCTGG + Intronic
1129231047 15:74197393-74197415 GCTGCTGCTCCTGGCCATGCTGG - Exonic
1132504927 16:303150-303172 GCTGCCTTTGCTGGCCGGGCGGG - Intronic
1133580330 16:7138584-7138606 GTTACATTTCCTGGCCATGAAGG - Intronic
1137856673 16:51801655-51801677 GCTCTATTGACTGGCCCTGCAGG + Intergenic
1138750983 16:59420682-59420704 CCTGCTTTTACTAGCCCTGCTGG + Intergenic
1140302786 16:73774381-73774403 GCTGCCTTCACAGTCCATGCTGG + Intergenic
1144098816 17:11925673-11925695 CCAGCATCTATTGGCCATGCAGG + Intronic
1152015819 17:77749600-77749622 GCTGCCTCTGCTGGCCCTGCAGG + Intergenic
1152310823 17:79548650-79548672 GCTGCATTGCCTGGACAGGCTGG - Intergenic
1157132578 18:45020796-45020818 GATTCATTTACAGACCATGCTGG - Intronic
1157820020 18:50760398-50760420 GCTGCATGCACTGGCAAGGCAGG - Intergenic
1161972544 19:7590672-7590694 GCTGCATTTGCTGCCTTTGCTGG + Intergenic
1164622136 19:29702762-29702784 GCAGCAGCTGCTGGCCATGCTGG - Exonic
1165395251 19:35560324-35560346 GCAGCAGTTACTGGGCAGGCAGG + Intronic
1166250186 19:41564557-41564579 GCGGAGTTGACTGGCCATGCAGG - Intronic
1167167090 19:47805710-47805732 GCTTCATCTACAGGACATGCTGG + Intronic
1167174726 19:47858017-47858039 GCTTCATCTACAGGACATGCTGG - Intergenic
928747662 2:34434215-34434237 GCTTTATATCCTGGCCATGCTGG + Intergenic
933504423 2:83159954-83159976 GCTTTATATCCTGGCCATGCTGG + Intergenic
939215994 2:139239009-139239031 GCTTTATATTCTGGCCATGCTGG - Intergenic
939943244 2:148377278-148377300 GCTTTATATCCTGGCCATGCTGG + Intronic
941273454 2:163459992-163460014 GAGCCATTTATTGGCCATGCTGG + Intergenic
941675213 2:168336965-168336987 GCTGCACTTCCTGGCCATGCAGG - Intergenic
942602501 2:177655942-177655964 ACTACATTTTCTGGCAATGCTGG + Intronic
944211499 2:197211006-197211028 GCTGCCTTTTCTCGGCATGCAGG - Intronic
945052048 2:205833364-205833386 GCTTTATATCCTGGCCATGCTGG - Intergenic
947466052 2:230347544-230347566 GCTTTGTTTACTGTCCATGCAGG + Intronic
948526382 2:238573501-238573523 GCTGCCCCTACTGGCCATGCAGG - Intergenic
1170095234 20:12638785-12638807 GCTGTACTTTCTGGCCATGTGGG + Intergenic
1170368636 20:15624248-15624270 CCTGCCTTTTCTAGCCATGCTGG + Intronic
1171892506 20:30728846-30728868 GCTGGAGCTTCTGGCCATGCTGG + Intergenic
1173740053 20:45394013-45394035 GCTTCCTTTCCTTGCCATGCGGG + Intronic
1174137091 20:48387136-48387158 GCTGCATTTCCAGGGCATGGTGG - Intergenic
1174770201 20:53292414-53292436 TGTGCATTTACTGGCCAGGAGGG - Intronic
1176614354 21:9016011-9016033 GCAGCATTTGCTGGACATGAGGG - Intergenic
1176710843 21:10147859-10147881 GCAGCATTTGCTGGACATGAGGG + Intergenic
1177760905 21:25401312-25401334 GCTTTTTTTTCTGGCCATGCTGG - Intergenic
1178370692 21:32024878-32024900 GCTTAATATCCTGGCCATGCGGG + Intronic
1179928738 21:44552580-44552602 GCTGCTTTGACTGGCCCTGTAGG - Intronic
1180011724 21:45055518-45055540 GCTGCCTTTTCTGGCGCTGCGGG - Intergenic
1181891866 22:26070270-26070292 TCTTTATTTACTGGCCATGTGGG - Intergenic
1182000210 22:26913837-26913859 GCTGCATATAGGGGCCATGGTGG - Intergenic
1183103078 22:35595793-35595815 GCTGCATTGGCTGGGCATGGTGG - Intergenic
1184876800 22:47281448-47281470 GCTGCATAGACTGGCCAAGAAGG - Intergenic
950236632 3:11327423-11327445 GCGGTATTCACTGGACATGCAGG + Intronic
950977152 3:17259777-17259799 GCCGCATTTAATGGCCATGATGG + Intronic
951181059 3:19659472-19659494 TCTGCATTTACTACCCAGGCAGG - Intergenic
953490142 3:43342854-43342876 TCTGCATTTACTGGCAATTTAGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
956904812 3:73754800-73754822 CCTTCATTTCCTGGCCATGTGGG - Intergenic
957897693 3:86445137-86445159 GCTTTATATTCTGGCCATGCTGG - Intergenic
958433623 3:94071723-94071745 GCTCCATTTACTGGTCTTCCAGG - Intronic
961318472 3:126056546-126056568 GGTGCATTGCCTGGCCATGGTGG - Intronic
966124386 3:176558714-176558736 TCTGCAGGTGCTGGCCATGCAGG + Intergenic
966465626 3:180228239-180228261 GTGGCATCTAATGGCCATGCAGG + Intergenic
969888839 4:10240818-10240840 GCTTTATATCCTGGCCATGCTGG + Intergenic
970736716 4:19179132-19179154 TCTGCATTTAGTTGGCATGCAGG - Intergenic
972808373 4:42554859-42554881 GCTTTATATTCTGGCCATGCTGG - Intronic
978855145 4:113386204-113386226 GCTTTATATTCTGGCCATGCTGG + Intergenic
982262568 4:153507802-153507824 GGTGCATCTAGTGGCCATGTTGG + Intronic
983490485 4:168383976-168383998 GCTTTATATTCTGGCCATGCTGG - Intronic
984651956 4:182280001-182280023 GCTCCATTATCTGGCCATGGAGG - Intronic
985910333 5:2874557-2874579 CCTCCATATACAGGCCATGCAGG + Intergenic
986851871 5:11822696-11822718 CCTTCATTTCCTTGCCATGCTGG - Intronic
986938020 5:12916221-12916243 GCTTTATATTCTGGCCATGCTGG + Intergenic
987580098 5:19778937-19778959 GCTTCGTTTACTGGCCAGGAAGG + Intronic
987680168 5:21125265-21125287 GCTTTATATCCTGGCCATGCTGG - Intergenic
988079499 5:26398888-26398910 GCTTTATATCCTGGCCATGCTGG + Intergenic
988251356 5:28761898-28761920 GCTGAAGTTAATGGCCATCCAGG - Intergenic
995806519 5:116058424-116058446 GCTGCATTTCCCAGCAATGCTGG + Intronic
996494299 5:124136027-124136049 GCTTTATATCCTGGCCATGCTGG - Intergenic
998448582 5:142217207-142217229 GCTGGATTCCCTGGCCATGGAGG + Intergenic
999873641 5:155777848-155777870 TCTGTATTTACAGGCCTTGCAGG + Intergenic
1000625334 5:163531765-163531787 ACTGCATTTACTGCACATGTAGG - Intergenic
1001546722 5:172575022-172575044 CCTGCTTTTTCTGGCCCTGCTGG + Intergenic
1003521169 6:6859962-6859984 ACTGCAGCCACTGGCCATGCCGG - Intergenic
1009309224 6:62128336-62128358 TCTACTTTTAATGGCCATGCAGG + Intronic
1010153054 6:72758945-72758967 GCTGAAATTTCTGGCCATTCTGG - Intronic
1014500161 6:122178385-122178407 TCTGCTTTTACTGGGGATGCTGG - Intergenic
1015208102 6:130665035-130665057 GCTGAATTCATTGGCCAGGCTGG + Intergenic
1018948764 6:168364977-168364999 GCTGCCATTTCTGGCCATGCTGG - Intergenic
1023089331 7:36603160-36603182 ACTGCAATGACTGGCCATGTAGG + Intronic
1024839601 7:53570541-53570563 GCTTTATATTCTGGCCATGCTGG + Intergenic
1030480023 7:110091337-110091359 GCTTTATATACTGGCCATGCTGG + Intergenic
1031729162 7:125276785-125276807 GCTTTATATCCTGGCCATGCTGG + Intergenic
1031833332 7:126652559-126652581 GCTTTATATTCTGGCCATGCTGG - Intronic
1033684123 7:143623246-143623268 CCTTGATTTACTGGCCCTGCAGG + Intronic
1033687299 7:143702465-143702487 CCTTGATTTACTGGCCCTGCAGG + Intronic
1033700489 7:143834377-143834399 CCTTGATTTACTGGCCCTGCAGG - Intergenic
1034842862 7:154415733-154415755 GCCCCATTTTCTGGCCAGGCTGG + Intronic
1034941891 7:155236173-155236195 AGTGCATTTACTGTCCCTGCCGG - Intergenic
1035279830 7:157770871-157770893 GCTGCCTCAACTGGCCAAGCGGG - Intronic
1035533688 8:375139-375161 GGTGGATCTACTGGCCAGGCAGG + Intergenic
1039926071 8:41933369-41933391 GCTGCAGCTGCTGCCCATGCTGG + Exonic
1041786997 8:61646145-61646167 GCTGCACTTACCAGCCATGTTGG + Intronic
1044761599 8:95523205-95523227 GCTGCATGTTCTGAACATGCTGG - Intergenic
1045145602 8:99340619-99340641 GCTGCATTTACTGGCTTTGAAGG - Intronic
1047266404 8:123313726-123313748 TCTGCTTTTAATAGCCATGCAGG - Intergenic
1049858596 8:144881541-144881563 GCTGGATTAGGTGGCCATGCTGG + Exonic
1050358422 9:4804673-4804695 GCCGCTTTGACTAGCCATGCAGG - Intronic
1053647828 9:40133555-40133577 GCAGCATTTGCTGGACATGAGGG + Intergenic
1053757905 9:41330291-41330313 GCAGCATTTGCTGGACATGAGGG - Intergenic
1054328800 9:63731506-63731528 GCAGCATTTGCTGGACATGAGGG + Intergenic
1054536752 9:66242615-66242637 GCAGCATTTGCTGGACATGAGGG - Intergenic
1055677211 9:78676180-78676202 GCTGAATTTACTAGCAAAGCAGG + Intergenic
1056873900 9:90309403-90309425 GCTGCTGTTACTGCCCAGGCTGG + Intergenic
1058020314 9:100079183-100079205 GCTTTATGTCCTGGCCATGCTGG - Intronic
1058549904 9:106103582-106103604 GCTTTATATTCTGGCCATGCTGG - Intergenic
1061430351 9:130526871-130526893 GCTGCATGTTCTGTCCTTGCGGG - Intergenic
1202795603 9_KI270719v1_random:116847-116869 GCAGCATTTGCTGGACATGAGGG + Intergenic
1203747862 Un_GL000218v1:53610-53632 GCTGGAGCTTCTGGCCATGCTGG - Intergenic
1203561870 Un_KI270744v1:64366-64388 GCTGGAGCTTCTGGCCATGCTGG + Intergenic
1191652949 X:63561164-63561186 TCTGCATTCACTGGCCATGGTGG - Intergenic
1191940818 X:66480083-66480105 GCTGTATATTCTAGCCATGCTGG + Intergenic
1195850457 X:109276934-109276956 CCTGCTTTTTCTAGCCATGCTGG - Intergenic
1195999681 X:110768544-110768566 CCTGCTTTTTCTGGCCTTGCTGG - Intronic
1196564849 X:117193085-117193107 GCTTTATATTCTGGCCATGCTGG + Intergenic
1197385405 X:125795575-125795597 CCTGCTTTTTCTAGCCATGCTGG - Intergenic
1198782728 X:140255285-140255307 GCTTTATATCCTGGCCATGCTGG + Intergenic
1199379684 X:147155622-147155644 GCTGCTTTTTCTAGCCATGCTGG + Intergenic
1199711687 X:150474087-150474109 GCTGCCTTTCCAGCCCATGCTGG + Intronic
1201161204 Y:11168604-11168626 GCTGGAGCTTCTGGCCATGCTGG - Intergenic