ID: 1103922175

View in Genome Browser
Species Human (GRCh38)
Location 12:124404728-124404750
Sequence TCAGCTCTCGGGGATCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103922175_1103922183 13 Left 1103922175 12:124404728-124404750 CCCCACAGATCCCCGAGAGCTGA 0: 1
1: 0
2: 2
3: 7
4: 148
Right 1103922183 12:124404764-124404786 ACTGTGCTGTCCATTTTCTATGG 0: 1
1: 0
2: 1
3: 24
4: 217
1103922175_1103922187 25 Left 1103922175 12:124404728-124404750 CCCCACAGATCCCCGAGAGCTGA 0: 1
1: 0
2: 2
3: 7
4: 148
Right 1103922187 12:124404776-124404798 ATTTTCTATGGGCCGGCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 61
1103922175_1103922184 14 Left 1103922175 12:124404728-124404750 CCCCACAGATCCCCGAGAGCTGA 0: 1
1: 0
2: 2
3: 7
4: 148
Right 1103922184 12:124404765-124404787 CTGTGCTGTCCATTTTCTATGGG 0: 1
1: 0
2: 0
3: 25
4: 208
1103922175_1103922185 18 Left 1103922175 12:124404728-124404750 CCCCACAGATCCCCGAGAGCTGA 0: 1
1: 0
2: 2
3: 7
4: 148
Right 1103922185 12:124404769-124404791 GCTGTCCATTTTCTATGGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103922175 Original CRISPR TCAGCTCTCGGGGATCTGTG GGG (reversed) Intronic
900612902 1:3551890-3551912 TCAGCTCTCAGGCTTCTGCGTGG - Intronic
901937786 1:12638712-12638734 TTAGACCTCAGGGATCTGTGAGG - Intergenic
904346278 1:29872367-29872389 TAAACTCTCAGGGACCTGTGGGG + Intergenic
904365419 1:30008001-30008023 TCAGCTCCCGGGGGTCCATGGGG + Intergenic
904453505 1:30632247-30632269 TCAGCTTCAGGGCATCTGTGGGG + Intergenic
905203553 1:36329928-36329950 TTAGCCCTGGGGGAGCTGTGCGG - Intergenic
906430325 1:45750714-45750736 CCAGTTCTCGGGGAACTGTACGG - Intergenic
910536859 1:88308406-88308428 TCAGCACTCGTGAATCAGTGTGG + Intergenic
911905640 1:103565154-103565176 TCATCTCTCCAGTATCTGTGGGG + Intronic
915901090 1:159847177-159847199 TCAGCTCTGGGAAAGCTGTGTGG + Intronic
916612807 1:166409824-166409846 TTAGCTCGCTGGGCTCTGTGGGG + Intergenic
917028948 1:170668933-170668955 TCAGCTCTGGGGACTCAGTGAGG - Intronic
919158671 1:193801063-193801085 TCAGTTCTGGGGTATATGTGTGG + Intergenic
922939752 1:229452096-229452118 TCTGCCCTCGGGGATGTGTTGGG + Intronic
1068170423 10:53386259-53386281 TCCACTCTTGGGGATCTCTGAGG - Intergenic
1068753656 10:60625282-60625304 TCATCTCTCATGGCTCTGTGGGG - Intronic
1069775321 10:70923860-70923882 TCAGCACCCGGGGCTCTGTCAGG + Intergenic
1073006165 10:100326506-100326528 CCAGATTTGGGGGATCTGTGAGG - Intronic
1076238060 10:128881194-128881216 TCAGATCTCTGGGAGCTGTTGGG + Intergenic
1076322486 10:129593694-129593716 GCAGCTTTCGGGCATGTGTGGGG + Intronic
1076322548 10:129594083-129594105 TCACCTCTGAGTGATCTGTGGGG + Intronic
1076774672 10:132688136-132688158 TCAGCTCTCTGGGGCCTGTTAGG - Intronic
1078369684 11:10734627-10734649 TCATGTCTGGGGGATCAGTGTGG + Intergenic
1080977144 11:37356789-37356811 TTAGCTTTCTGGGCTCTGTGGGG - Intergenic
1081674364 11:44960027-44960049 TCAGCTTGCGGGGGTCTATGGGG - Intergenic
1082903822 11:58284982-58285004 TCACCTCTCAGGGGTCTTTGAGG + Intergenic
1083471067 11:62884350-62884372 CCAGCTCCCGGGGAAGTGTGTGG + Intronic
1084463193 11:69307614-69307636 CCAGCTCTCGGGGTTGTGGGGGG + Intronic
1085325747 11:75605432-75605454 ACAGATCTTGGGGATCTGGGAGG + Intronic
1088994810 11:114986983-114987005 TTAGCTATTGAGGATCTGTGTGG - Intergenic
1090830218 11:130416056-130416078 TCAGCTCTAAGGGCCCTGTGAGG + Intronic
1090919153 11:131192969-131192991 TCTGCTGTCGGTGATATGTGAGG - Intergenic
1091979962 12:4856808-4856830 CCAGCTCAGGGGGCTCTGTGAGG + Intergenic
1097426086 12:59446330-59446352 TCATCTCTCTTGGAGCTGTGAGG + Intergenic
1097478657 12:60092167-60092189 TTAGCCCTGGGGGAGCTGTGCGG + Intergenic
1101923440 12:108951890-108951912 TCCCCTCCTGGGGATCTGTGTGG + Intronic
1103903031 12:124313211-124313233 TCACCTCTGGGGGTTCAGTGGGG + Intronic
1103922175 12:124404728-124404750 TCAGCTCTCGGGGATCTGTGGGG - Intronic
1104108933 12:125688123-125688145 TCAGCTCTCTGCACTCTGTGGGG + Intergenic
1104276075 12:127329110-127329132 TCAGGGCTCTGGGATCTCTGGGG - Intergenic
1112578762 13:100660481-100660503 TCATCTCACAGGGATCTATGTGG + Intronic
1113750406 13:112773073-112773095 ACAGCCCTCGGGGCTCTGGGAGG - Intronic
1114491010 14:23102025-23102047 TCAGCTCTGGGGGAAGTGGGAGG - Intergenic
1116011046 14:39352544-39352566 TCACCTCTTTGGTATCTGTGGGG + Intronic
1121043803 14:90773637-90773659 TGAGCTCTCTGGCAGCTGTGAGG + Intronic
1122481143 14:102048285-102048307 GCAGCTCTCGGGGCTCTCTAGGG - Intronic
1123016848 14:105379840-105379862 TCTGCTCTGGGAGATCAGTGTGG - Intronic
1126050820 15:44683307-44683329 TCAGCTTGCTGGGCTCTGTGGGG - Intronic
1129772579 15:78212363-78212385 TGAGCTCTCATGGATCTTTGGGG + Intronic
1132516278 16:367585-367607 ACAGATCCCGGGGAGCTGTGAGG - Exonic
1136555101 16:31002989-31003011 TGAGCTGTCTGGGATCTGTCTGG - Intronic
1138533388 16:57647014-57647036 TCAGGTCCCAGGGGTCTGTGCGG + Intronic
1140409501 16:74733469-74733491 CCAGCTCTTGGGAAACTGTGTGG - Intronic
1141602414 16:85134720-85134742 TCAGCGCTCCTGGATCAGTGGGG - Intergenic
1142201637 16:88763869-88763891 GCAGCTCTCCGGGCTCTGTGAGG + Intronic
1143058941 17:4183839-4183861 TCTGGTCTCGGGAATCTTTGAGG + Exonic
1146129442 17:30258696-30258718 ACAGCTCTCCAGGATCTCTGAGG + Intronic
1147388566 17:40095847-40095869 TCAGGGCTTGGGGATCTGGGAGG + Exonic
1148387120 17:47242320-47242342 TGAGTTCCTGGGGATCTGTGAGG - Intergenic
1149427620 17:56570236-56570258 TCAGGCCTCGGGGCTGTGTGGGG + Intergenic
1151751880 17:76043758-76043780 TCAGCTGTGGAGGAGCTGTGAGG - Intronic
1155734447 18:29203190-29203212 ACAGCTCTTGGGGATCCATGAGG - Intergenic
1156148702 18:34218528-34218550 TCAGCTCGCAGGGAACAGTGGGG - Intronic
1156394291 18:36684123-36684145 TCAGTTTTCTGGGATCTGGGTGG - Intronic
1158274205 18:55748677-55748699 AGAGCTTTCAGGGATCTGTGTGG + Intergenic
1163722206 19:18903636-18903658 TCAGCACTCCGGGAGCTGGGTGG - Intronic
1165446616 19:35860289-35860311 TCACCTCTGGGGGGTCTGTGAGG - Exonic
1165832351 19:38736006-38736028 TCAGGTCTCGGGGGTCTCGGGGG + Intronic
1168013729 19:53554890-53554912 TGCGCTCTGGGGGATATGTGGGG + Intronic
926508575 2:13745392-13745414 TCAGCTTTCTGGGCTCTGTGGGG - Intergenic
927182782 2:20458823-20458845 TTAGCTTTCTGGGATCTGTGGGG - Intergenic
928367856 2:30716486-30716508 TCAGTTCTCTGGGAACTGGGAGG + Intergenic
930338432 2:50080943-50080965 TCTGCTCTAGGTGATCTTTGAGG - Intronic
933526403 2:83445937-83445959 TCAGCTATCTGGGTTGTGTGTGG - Intergenic
934860797 2:97762377-97762399 TCTGCACTCGGGGATTTGAGGGG + Intronic
935568517 2:104634973-104634995 TTAGCTTTCTGGGAGCTGTGGGG - Intergenic
936035780 2:109110025-109110047 TCAGATCTCCAGGATCTGAGAGG - Intergenic
937509427 2:122577426-122577448 TCAGCTCTTGGCGAGCAGTGGGG + Intergenic
945528284 2:210917187-210917209 GGAGCTCTCGGGGATTTCTGCGG + Intergenic
946790231 2:223293545-223293567 TTAGCTTACGGGGCTCTGTGGGG + Intergenic
1171473329 20:25389876-25389898 TCAGAACTCGGGGACCTTTGGGG - Intronic
1174979565 20:55378291-55378313 TCTGCCCTCTGGTATCTGTGTGG - Intergenic
1176371785 21:6066745-6066767 TTACTTCTGGGGGATCTGTGAGG - Intergenic
1177440218 21:21113119-21113141 ATAGCTTTCGGGGTTCTGTGAGG + Intronic
1178503749 21:33146694-33146716 TCAGCTCTCTGGGGACTCTGGGG - Intergenic
1179377404 21:40862907-40862929 AGAGCTCTGGGGGCTCTGTGTGG + Intergenic
1179751734 21:43471794-43471816 TTACTTCTGGGGGATCTGTGAGG + Intergenic
1180694667 22:17744104-17744126 TCAGCTCTCTGGGACCTGTGAGG - Intronic
1181405742 22:22684081-22684103 TTAGCGCTGGAGGATCTGTGGGG - Intergenic
1184514024 22:44949747-44949769 TCTGTTCTCGCGGCTCTGTGAGG - Intronic
950264687 3:11564973-11564995 TCCGCTCCCGGGGGTCTCTGCGG + Exonic
950454146 3:13082752-13082774 TTGGCTCTCGGAGACCTGTGCGG + Intergenic
959007856 3:101040609-101040631 TCAGCCCTCGGGGACCTGCAAGG + Intergenic
960169597 3:114443386-114443408 TAAGCTGTTGGGGGTCTGTGGGG + Intronic
960206790 3:114911583-114911605 TCAGCTATAGGGTATCTGTTTGG - Intronic
961452244 3:127007595-127007617 CCAGCTGTCGGGGAGGTGTGAGG + Intronic
961998262 3:131269190-131269212 TTAGCTTTCTGGGCTCTGTGGGG + Intronic
962444556 3:135453027-135453049 TCACCTCTCAGGGCTCTCTGTGG - Intergenic
964538014 3:157746953-157746975 TGAGCTCTTGGGGTTCTGCGTGG + Intergenic
964662739 3:159138641-159138663 TCATCACTCTGGGCTCTGTGTGG + Intronic
966691604 3:182747456-182747478 TGAGCTCTTAGGTATCTGTGGGG + Intergenic
966760449 3:183413463-183413485 TTAGCCCTGGGGGAGCTGTGAGG - Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
979822517 4:125191928-125191950 TCAGCTTGCGGGGAGGTGTGGGG + Intergenic
980791876 4:137631561-137631583 CCAGCTCTTGAGCATCTGTGGGG - Intergenic
982421889 4:155208426-155208448 CCAGCTCTCGCGGAACTGGGGGG + Intergenic
983431508 4:167656924-167656946 TCAGCTCTGTGAGATCTGTTAGG - Intergenic
984055851 4:174928441-174928463 TTAGCCCTGGGGGAGCTGTGCGG + Intronic
985698994 5:1359095-1359117 TCAGCTCTCGGGGATAGGTGAGG + Intergenic
985772796 5:1823707-1823729 TCATCTGTCAGGGATCTATGAGG + Intergenic
985833529 5:2253117-2253139 TCAGCGCTCGCGGAGCTCTGGGG - Intergenic
986061604 5:4196942-4196964 TCAGTCTCCGGGGATCTGTGTGG + Intergenic
988628032 5:32898787-32898809 TTAGCTTTCTGGGCTCTGTGGGG + Intergenic
992038888 5:72808951-72808973 TTAGCTTTCTGGGTTCTGTGGGG + Intergenic
995117753 5:108500772-108500794 ACAGCTCTGGGAGCTCTGTGTGG - Intergenic
995280644 5:110331736-110331758 GCAGCTCTCTGGGATCTTTTAGG - Intronic
998539453 5:142966242-142966264 ACAGCTCTCAGGTATCTGTATGG + Intronic
999663779 5:153892222-153892244 TCATTTCTCTGGGGTCTGTGAGG - Intergenic
1001416015 5:171545305-171545327 TCAGCGCTCAGGAATCAGTGAGG - Intergenic
1002996107 6:2286743-2286765 TCAGCTTGCTGGGCTCTGTGGGG - Intergenic
1003986258 6:11438025-11438047 TGTGCTCTCTGGGATCTGTAAGG + Intergenic
1004023011 6:11791341-11791363 TTAGCCCTGGGGGAGCTGTGCGG - Intronic
1005208559 6:23432742-23432764 TTAGCTTGCTGGGATCTGTGGGG + Intergenic
1005534104 6:26737231-26737253 TGACATCTCAGGGATCTGTGAGG - Intergenic
1005536691 6:26764423-26764445 TGACATCTCAGGGATCTGTGAGG + Intergenic
1007119844 6:39370796-39370818 AGAATTCTCGGGGATCTGTGTGG + Intronic
1007428129 6:41760214-41760236 TCAGCTCCCTGGAATCTGAGCGG - Intergenic
1008407610 6:51136362-51136384 TTAGCTTGCTGGGATCTGTGGGG + Intergenic
1009007591 6:57806833-57806855 TGACATCTCAGGGATCTGTGAGG + Intergenic
1010039160 6:71361243-71361265 TTAGCTTGCTGGGATCTGTGGGG + Intergenic
1015962987 6:138669725-138669747 TCAGCTTTCCAGGAGCTGTGTGG - Intronic
1018160910 6:161041413-161041435 TCAGCCCACAGGCATCTGTGAGG + Intronic
1018345932 6:162899392-162899414 TCACCTTTCTAGGATCTGTGTGG + Intronic
1020945329 7:14598917-14598939 GCAACTCTCAGGGAGCTGTGAGG + Intronic
1023360216 7:39407845-39407867 TCAGCCCTCGGGGTTCTGACGGG - Intronic
1023652764 7:42388810-42388832 TCTGCTCCCGGGGAGCTGTCAGG + Intergenic
1023868033 7:44248126-44248148 TCAGCTCCCAGGGATCTGAGGGG + Intronic
1024216949 7:47255960-47255982 TCTTCTCTCTGGGATCTGTGAGG + Intergenic
1026437893 7:70415882-70415904 TCAGCTGTCGGCGCTGTGTGAGG - Intronic
1028010246 7:85633445-85633467 TCTTCTCTCTGAGATCTGTGAGG - Intergenic
1028378103 7:90168354-90168376 TTAGCTTGCTGGGATCTGTGGGG - Intronic
1032262414 7:130347809-130347831 TCACTTCTCGGGGATCTGGAGGG + Exonic
1032350682 7:131160313-131160335 TCAGCTCTTGGGCATTTGGGTGG + Intronic
1032831796 7:135634719-135634741 TAAGCTCTCGGGAAGCGGTGAGG + Intronic
1036090388 8:5658471-5658493 TCAGCACTGGGGGATGTGGGAGG - Intergenic
1038615659 8:29091669-29091691 TCAGTTCTGGTGGATCTCTGGGG + Intronic
1041482445 8:58337050-58337072 TAAGCACTCGTGGCTCTGTGTGG + Intergenic
1042837585 8:73092431-73092453 TCAACCCTCGGGGATCTTTGGGG - Intronic
1045545075 8:103121423-103121445 TCAGCTCTGAGGCAGCTGTGGGG + Intergenic
1047759217 8:127941852-127941874 TCAGCTCTGGGCCATGTGTGTGG + Intergenic
1048172580 8:132121844-132121866 TTAGCTCTCGGGGCTTGGTGTGG - Exonic
1049387214 8:142349054-142349076 TCAGCTCTTGGCCTTCTGTGTGG - Intronic
1185699377 X:2218923-2218945 TTAGCCCTGGGGGAGCTGTGTGG - Intergenic
1187940627 X:24377412-24377434 TTAGCTGTGTGGGATCTGTGTGG - Intergenic
1190983998 X:55484293-55484315 TGAGCTCTCTGGCATGTGTGTGG - Intergenic
1191098986 X:56704854-56704876 TTAGCTTGCTGGGATCTGTGGGG + Intergenic
1191908959 X:66127143-66127165 TTAGCTTGCTGGGATCTGTGGGG + Intergenic
1199145530 X:144361898-144361920 TCAGGTAAAGGGGATCTGTGAGG - Intergenic