ID: 1103922942

View in Genome Browser
Species Human (GRCh38)
Location 12:124408785-124408807
Sequence GAAGGTTACAAGCACTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103922939_1103922942 20 Left 1103922939 12:124408742-124408764 CCATCTCTAAAAAAATAATAAAT 0: 3
1: 101
2: 1251
3: 11023
4: 139043
Right 1103922942 12:124408785-124408807 GAAGGTTACAAGCACTCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103922942 Original CRISPR GAAGGTTACAAGCACTCCAA GGG Intronic
900297633 1:1959973-1959995 GAAGGTGACAAGCACTTCACAGG + Exonic
901118534 1:6869523-6869545 GAAGGCTAGAAGCCATCCAAGGG - Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
908987736 1:70045243-70045265 GAAAGTTACCAGCACTCCACTGG - Intronic
912498690 1:110107616-110107638 GAAGTTCACAACCACTCCCAGGG - Intergenic
915212289 1:154319373-154319395 GAAGGTTACATGCCCTCCTATGG - Intergenic
922559904 1:226561796-226561818 GTAAGTTAGAAGCATTCCAAGGG - Intronic
1065208862 10:23383012-23383034 GAAGGGTAAAAGGACACCAAAGG + Intergenic
1066029494 10:31405539-31405561 AAAGTTTACAAGCACTATAAAGG - Intronic
1067790606 10:49284589-49284611 GAAGGTTCCAAACCCTCCCAGGG - Intergenic
1082954340 11:58852932-58852954 GTTGGTTACAAGCACTTCACTGG - Intronic
1086508083 11:87527095-87527117 GAAGTTTACATGCCCTCCCAAGG - Intergenic
1089284001 11:117394186-117394208 GAGGGTTACAAGCACAGCACCGG - Intronic
1092054729 12:5499436-5499458 GCAGGTTAGAAGCACTCCGAGGG + Intronic
1096129656 12:49147686-49147708 GAAGATTACTAGAACTCCACAGG - Intergenic
1098094979 12:66945497-66945519 GAAGCTTACAATCACAGCAAGGG + Intergenic
1098499629 12:71176326-71176348 AGAGGTTACAAGCAATTCAAAGG + Intronic
1102011174 12:109619515-109619537 AAGGGTTACAAGTTCTCCAAGGG - Intergenic
1103922942 12:124408785-124408807 GAAGGTTACAAGCACTCCAAGGG + Intronic
1104243296 12:127012505-127012527 GAACTTTACAAAAACTCCAAAGG - Intergenic
1106006641 13:25776272-25776294 GAATGTTCCAAGCAATCAAAAGG + Intronic
1106025375 13:25950823-25950845 CAAGGTTACAAGCTCTACAGAGG - Intronic
1106126890 13:26908058-26908080 GAAGGATACAAGGGCTCCCAGGG - Intergenic
1106880346 13:34122481-34122503 AAAGGTTATAAGTTCTCCAAGGG + Intergenic
1110847942 13:80210904-80210926 GAAGATTAAAAGCCCTCCATGGG + Intergenic
1115196971 14:30812049-30812071 GAAGGATGCAGACACTCCAAAGG + Intergenic
1117691432 14:58311430-58311452 AAAGGTTACAAGCACTGGCAAGG + Intronic
1119804519 14:77474292-77474314 GTAAGTTACAAGCACACCCATGG + Intergenic
1120292802 14:82598134-82598156 GATGGACACAAGCATTCCAAAGG - Intergenic
1120916525 14:89715389-89715411 GAAGGTAACAGGCTCTCCCAAGG + Intergenic
1125208119 15:37178034-37178056 GAAGGAAACAACCACTGCAATGG - Intergenic
1137809735 16:51341515-51341537 GGAGTTTACAAGCACGCCACAGG - Intergenic
1141728941 16:85809137-85809159 GCAGGCCACAAGCAGTCCAAGGG - Intergenic
1143948300 17:10613611-10613633 GAAGGATACAAGGAATCAAAAGG - Intergenic
1151588786 17:75029425-75029447 GAAGCTTAAAAGCAATCCATAGG - Intergenic
1165616012 19:37201132-37201154 GAAATGTACAAGGACTCCAAAGG + Intronic
925427857 2:3765727-3765749 GAAGGTTAGAAGCCACCCAAGGG - Intronic
929437931 2:41942334-41942356 GAAGGTAGAAAGCACTCCAAGGG - Intronic
935165716 2:100567085-100567107 TGGGGTTACCAGCACTCCAAGGG - Intronic
937201809 2:120208900-120208922 GAACGTTACAAGAAATCCAGAGG - Intergenic
941083603 2:161090965-161090987 CAACATTACAAGAACTCCAAAGG + Intergenic
943670398 2:190654166-190654188 TTAGGTTATAAGCACCCCAAGGG - Intronic
949343308 3:3052447-3052469 GTATTTTACAAGCACCCCAATGG + Intronic
960860824 3:122151604-122151626 GAAGATTTTAATCACTCCAAAGG + Intergenic
961069699 3:123911074-123911096 GAAGATTCCAAGCACACCAGGGG - Intronic
962377232 3:134868423-134868445 GAAGGTTACAAGGAATACAGAGG + Intronic
962862975 3:139421750-139421772 TAAGGTTACAGGAACTCCACTGG - Intergenic
964153827 3:153561414-153561436 GTAGGTTACCATCATTCCAAAGG - Intergenic
966150065 3:176857992-176858014 TAAGGATACAAGCAATCAAAAGG + Intergenic
968484987 4:855549-855571 CAAAGTTACACGCACTACAAAGG - Intronic
973030549 4:45332146-45332168 GAAAGTCACAAGTACTCCAAGGG + Intergenic
974673512 4:65061655-65061677 GAAGATTTCAGGCAATCCAATGG + Intergenic
981800308 4:148648047-148648069 GAAGGTGACTATCACTCCCAGGG + Intergenic
984177236 4:176434661-176434683 AAAAGCTAGAAGCACTCCAACGG - Intergenic
993037929 5:82777734-82777756 GTAGGTTACCAGCACTCACAGGG - Intergenic
993665828 5:90694483-90694505 GTAGATCACAAACACTCCAAAGG - Exonic
996209373 5:120786930-120786952 AAAGTTTTCAAGCACTTCAAGGG - Intergenic
996273923 5:121641265-121641287 GAATGTTACATCCCCTCCAAAGG + Intergenic
999760763 5:154699237-154699259 GAAGGACACAAACACTTCAATGG + Intergenic
1004948575 6:20643085-20643107 AGAGGTTACGAGCACTCTAAGGG + Intronic
1007180958 6:39928834-39928856 GAAGGTCTCAGGCCCTCCAAAGG + Intronic
1008697755 6:54061066-54061088 AAAGCTTACAAAAACTCCAAAGG + Intronic
1014601634 6:123419987-123420009 CAAGGTTTCAATCACTCCACTGG - Intronic
1022852135 7:34274585-34274607 GAAGGTCACACACACTCAAAAGG - Intergenic
1033989681 7:147268033-147268055 GTAGGTTACAAGCAGGTCAAGGG - Intronic
1036127060 8:6072606-6072628 GAAAGTTACAAGCACGTCAGTGG + Intergenic
1043859178 8:85296148-85296170 GAAGGTTGCAGGCACAACAAGGG - Intergenic
1045239120 8:100383274-100383296 GAAGGTTAAAAGTACAACAATGG + Intronic
1045738578 8:105325024-105325046 GAAGGTAACAAAGAATCCAAGGG - Intronic
1052458004 9:28725895-28725917 CAAGGTTATAAGCACTGAAAGGG + Intergenic
1055638339 9:78298700-78298722 CCAGGTTACATGCAGTCCAAGGG - Intronic
1060416894 9:123437084-123437106 GTAGGCTCCAAGCACTCCCAGGG - Intronic
1187008071 X:15251280-15251302 GAAACTTACAACCTCTCCAAAGG + Intronic
1187093719 X:16124380-16124402 GAAAGTTACATGCTCTCCAAGGG + Intronic
1187221133 X:17327341-17327363 AAAGTTTAGAATCACTCCAAAGG - Intergenic
1187807456 X:23136598-23136620 CAAGGATATAAGCACTCAAAAGG + Intergenic
1188912068 X:35861685-35861707 GAATGTTACTAGCACACCAAGGG - Intergenic
1191852479 X:65595689-65595711 GAATTTTACAAGCACTGAAAAGG - Intronic