ID: 1103925424

View in Genome Browser
Species Human (GRCh38)
Location 12:124421195-124421217
Sequence GTCCCCGCCGGCCTCTCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103925421_1103925424 2 Left 1103925421 12:124421170-124421192 CCTCACTCACTGTCAAGACCTGA 0: 1
1: 0
2: 1
3: 26
4: 203
Right 1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG 0: 1
1: 0
2: 2
3: 8
4: 105
1103925416_1103925424 28 Left 1103925416 12:124421144-124421166 CCACCTGGCTCCCAGCCAGACGT 0: 1
1: 0
2: 1
3: 25
4: 220
Right 1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG 0: 1
1: 0
2: 2
3: 8
4: 105
1103925417_1103925424 25 Left 1103925417 12:124421147-124421169 CCTGGCTCCCAGCCAGACGTCAG 0: 1
1: 0
2: 1
3: 21
4: 223
Right 1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG 0: 1
1: 0
2: 2
3: 8
4: 105
1103925419_1103925424 17 Left 1103925419 12:124421155-124421177 CCAGCCAGACGTCAGCCTCACTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG 0: 1
1: 0
2: 2
3: 8
4: 105
1103925420_1103925424 13 Left 1103925420 12:124421159-124421181 CCAGACGTCAGCCTCACTCACTG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG 0: 1
1: 0
2: 2
3: 8
4: 105
1103925418_1103925424 18 Left 1103925418 12:124421154-124421176 CCCAGCCAGACGTCAGCCTCACT 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG 0: 1
1: 0
2: 2
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103925424 Original CRISPR GTCCCCGCCGGCCTCTCCGT TGG Intronic
900127593 1:1075430-1075452 GTGCCCGCCGACCCCTCAGTAGG + Intergenic
900176762 1:1294585-1294607 GTCCCCGTCTGCCTCACCGCTGG + Exonic
900610945 1:3544429-3544451 GCCCTCGGGGGCCTCTCCGTTGG + Intronic
900919704 1:5662508-5662530 GTCCCCGCCACCCTCTCCTGGGG + Intergenic
902658723 1:17887002-17887024 GTCCCTGCTGGCCTCTCCGTAGG + Intergenic
907319544 1:53594020-53594042 GTCCCAGGCGGCCTCTCCTGGGG + Intronic
912517715 1:110226524-110226546 GTCACTGCCAGCCTCTCCCTAGG + Intronic
915102566 1:153511037-153511059 GACCCCTCAGGCCTCTCCGCAGG + Intergenic
922724682 1:227917407-227917429 GCCCCCACCGGCCTCTTAGTAGG + Intergenic
924517772 1:244780612-244780634 GCCCCCACCTGCCCCTCCGTGGG + Intergenic
1062910704 10:1209825-1209847 GTCCCCTCCGTCCTCTGTGTGGG - Intronic
1066460506 10:35608454-35608476 GTCCTGGGCGGCCTCTCGGTGGG - Exonic
1069568741 10:69481270-69481292 GTCCCTGCCGGCCTGTGTGTTGG + Intronic
1071412949 10:85414482-85414504 GTCCCCCCAGGCATCTCTGTTGG - Intergenic
1075536306 10:123275012-123275034 TTCCCCGCCGCCCCCTCCGCCGG - Intergenic
1077229096 11:1450653-1450675 GTGCCAGCCGGGCTCTCCTTTGG - Exonic
1084575242 11:69984867-69984889 GTCCCCCACGGCCTCTCCTGTGG + Intergenic
1090203941 11:124874816-124874838 GTCCCTGCTGGCCTCTCCATGGG - Exonic
1091402464 12:189225-189247 GTCCCCGCCGCCCTCCCCCGGGG - Intergenic
1096242373 12:49966258-49966280 GTCCCCACCGTCCTCTCCTCTGG + Intergenic
1096503612 12:52080030-52080052 GTCGTCGCCGTCCTCTCCGCTGG - Intergenic
1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG + Intronic
1107559656 13:41547713-41547735 GTCCCAGCAGGCATCTCCTTAGG - Intergenic
1118875984 14:69785155-69785177 GTCCCTGCCAGCCTCCCCCTTGG - Intronic
1120080976 14:80216034-80216056 CTCCCAGCAGCCCTCTCCGTAGG + Intronic
1122882225 14:104695312-104695334 GTCCCCCCATGCCTCTCCCTGGG + Intronic
1125753284 15:42045123-42045145 CTCCCCACCGGCCTCCACGTGGG - Intronic
1130261184 15:82355452-82355474 GTCCCCTGCGGCCGCTCGGTGGG + Intergenic
1130280051 15:82513566-82513588 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1130471426 15:84229752-84229774 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1130478920 15:84344323-84344345 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1130492850 15:84443808-84443830 GTCCCCTGCGGCCGCTCGGTGGG + Intergenic
1130593720 15:85234379-85234401 GTCCCCTGCGGCCGCTCGGTGGG - Intergenic
1132191590 15:99867050-99867072 GTCCCCGCCAGGCTCTGGGTTGG - Intergenic
1132321699 15:100930274-100930296 GTTGCCGGCGGCCTGTCCGTGGG - Intronic
1132527750 16:426015-426037 GGCCCCGCCGGCCTCGCCCCCGG + Exonic
1132642748 16:985156-985178 GCCCCCGCCGGCCCCTTCGCCGG + Exonic
1132808553 16:1787002-1787024 GTCCGTGCCGGCCTCTCCTGTGG + Intronic
1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG + Intergenic
1134290887 16:12902213-12902235 GCCCTCGCTGGCCTCTCCGGAGG - Exonic
1135800442 16:25489199-25489221 CTGCTCGCCGGCCTCTCCCTGGG - Intergenic
1139489608 16:67279339-67279361 CCCGCCGCCGTCCTCTCCGTGGG - Exonic
1141906078 16:87027940-87027962 GTCCCCCCCAGCCTCTCCCCAGG - Intergenic
1141947053 16:87317605-87317627 GGCCCCTCCGGCCCATCCGTCGG - Intronic
1142156031 16:88533268-88533290 CTCCGCTCTGGCCTCTCCGTTGG - Exonic
1142231502 16:88902220-88902242 CTGCCTGCCGGCCTCTCCCTGGG - Intronic
1142245826 16:88969627-88969649 GGCCCCGCCCCCCTCTCCCTCGG - Intronic
1142799546 17:2336982-2337004 GTCCTTCCCGGCCGCTCCGTGGG - Exonic
1147971010 17:44219170-44219192 GGCCCCGCCGCCCCCTCCGGCGG + Intronic
1148551114 17:48551293-48551315 GCCCCCGCCGCCCTCCCCTTCGG + Intronic
1149085515 17:52710570-52710592 GTTCCCACCTGCCTCTCTGTAGG - Intergenic
1149085523 17:52710611-52710633 GTTCCCACCTGCCTCTCTGTAGG - Intergenic
1152426657 17:80221714-80221736 TTCGTCGCCGGCCTCTCAGTTGG + Exonic
1156242462 18:35267330-35267352 GGTCCCGCCCGCCTCTCCGTCGG - Intronic
1157513535 18:48295392-48295414 GTCCCTGGTGGCCTCTTCGTGGG + Intronic
1158489281 18:57895326-57895348 GTCCCCTCAGGCTTCTCCGTGGG - Intergenic
1160540111 18:79616736-79616758 GGCCCCGGCGGCCTCCACGTGGG - Intergenic
1160842906 19:1154456-1154478 CTCCCCGGCCGCCTCTCCCTCGG + Intronic
1160993475 19:1871297-1871319 GTCCCTGCAGGCCTGTCCGGAGG - Intergenic
1161069359 19:2252650-2252672 CTCCCGGACGGCCTCTCCGGTGG + Exonic
1163455894 19:17405411-17405433 GTCCCGGCAGGCCTCGCTGTTGG + Exonic
1166045317 19:40226490-40226512 GTCCCCGACGGCTTCCCCGCGGG - Exonic
1166960812 19:46494976-46494998 GACCCCGACGGCCCCTCCTTGGG + Exonic
1168153995 19:54463264-54463286 GACCCCGCCGACTTCTCGGTGGG - Exonic
925376186 2:3387952-3387974 GTCGCCGTCGGCCTCGCCGCTGG - Exonic
926735502 2:16070562-16070584 CTCCTCGCTGTCCTCTCCGTAGG + Intergenic
932765110 2:74464605-74464627 TTCCACGACGGCCTCTCCTTCGG - Exonic
932887516 2:75560828-75560850 GACCCCGGCGGCCCCTCCGCCGG - Intronic
934579509 2:95427260-95427282 TTCACAGCCCGCCTCTCCGTGGG - Intergenic
934599935 2:95649464-95649486 TTCACAGCCCGCCTCTCCGTGGG + Intergenic
935838284 2:107078842-107078864 GTCCCTGCCTACCTCTCAGTAGG - Intergenic
937083641 2:119157316-119157338 GTCCCTGCCTGCCTCTCCGTGGG - Intronic
944843116 2:203642956-203642978 CTCCCCCCCGCCCCCTCCGTGGG - Intergenic
947741423 2:232486707-232486729 GTGGCCGCCGGCCTCCTCGTGGG + Exonic
947770912 2:232669319-232669341 CTGACCGTCGGCCTCTCCGTGGG + Intronic
1171369030 20:24648599-24648621 GGCCCTGCTGGCCTCTCCCTGGG - Intronic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1175931104 20:62494117-62494139 GTCCCTGCCTGCGTCTCCATGGG + Intergenic
1180090243 21:45530606-45530628 GTCCCCACTTGCCTCTCCCTGGG - Intronic
1181756533 22:25028552-25028574 GTCCCCGCAGGCTTCTGGGTGGG - Exonic
1183154571 22:36065422-36065444 GCCCCTACAGGCCTCTCCGTGGG - Intergenic
1183501394 22:38181690-38181712 GTCTCCGCCGGACCCTCCTTTGG - Exonic
1183513237 22:38248141-38248163 GTCCCAGCCAGCCTCTCCCCTGG + Intronic
1185037829 22:48489162-48489184 GGCCCGGCCGTCCTCCCCGTGGG + Intergenic
950282289 3:11719152-11719174 GTCCCCGCCGGCCTCAGGGAGGG - Intronic
950370924 3:12529806-12529828 CTCTCCGCAGGCCTCTCAGTTGG + Exonic
952713302 3:36453431-36453453 GGGCCGGCCGGCCTCTCCGAGGG - Intronic
954618624 3:51983357-51983379 GTCCCCGCCCGCCTCTGGTTCGG - Exonic
968556415 4:1248407-1248429 GTCGCCGGCGGCCTCCCCGCGGG + Intronic
968845782 4:3040942-3040964 GCCCCCGCTGGCCTCTCCCTGGG - Intergenic
981010289 4:139918351-139918373 GGCCGCGCTGGCCTCTCCGAGGG + Intronic
982026697 4:151258814-151258836 TTCCCCACTGGCCTCTCCCTGGG + Intronic
999287241 5:150401510-150401532 GGCCCCGCAGGCATCTCTGTGGG + Intergenic
1008013351 6:46491306-46491328 GTGCCCGCGGGCCTTTGCGTGGG + Exonic
1014228644 6:118877088-118877110 GTCCACACAGGCCTCTCTGTAGG - Intronic
1019305677 7:333187-333209 CCCCCCGCCGGCCCCTCCCTGGG - Intergenic
1019481832 7:1270477-1270499 GTCCCCGCCGCCCACTCCAGTGG + Intergenic
1023000381 7:35801669-35801691 GTCCCCGGCCGCATCCCCGTCGG + Intronic
1023940035 7:44763301-44763323 CTCCACCCCGTCCTCTCCGTTGG - Exonic
1025007100 7:55363500-55363522 GCACCCGCCGGCCACCCCGTAGG + Intergenic
1027260586 7:76461957-76461979 GTCCCCGCCGCCCCGGCCGTCGG - Intronic
1027311965 7:76960070-76960092 GTCCCCGCCGCCCCGGCCGTCGG - Intergenic
1029654177 7:101913510-101913532 GTCCCCACCTGCCCCTCCCTGGG - Intronic
1031136684 7:117892307-117892329 GTCCTCGTCGGCCTCTCCTTAGG - Intergenic
1034739242 7:153457862-153457884 GTCCCCACCTGCCTCTCCATGGG - Intergenic
1035396333 7:158537437-158537459 GCCCCCGCTGGCCTGTCCTTGGG - Intronic
1035534678 8:382007-382029 TTCCCCGCTGGCCTCTCAGGGGG - Intergenic
1035686058 8:1524216-1524238 CTCCCTGCCGGCCTCTCAGATGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1047499615 8:125431112-125431134 GCCCCCGCCTGCCGCTCCGGGGG + Exonic
1056787970 9:89606072-89606094 GTCCCCGCCGGGCTGTCACTCGG - Exonic
1057297730 9:93859366-93859388 ACCCCTGCCGGACTCTCCGTGGG + Intergenic
1060106760 9:120877375-120877397 GGCCGCGCCGGCCTCGCCATTGG + Intronic
1062265112 9:135683439-135683461 GTCCCCGCCAGCCTGACCCTTGG + Intergenic
1062269732 9:135702920-135702942 TTCCCCGCTGGCCTATCCCTGGG + Intronic
1200073181 X:153538885-153538907 GCCCTCGCCAGCCTCTCCCTTGG - Intronic