ID: 1103926479

View in Genome Browser
Species Human (GRCh38)
Location 12:124426326-124426348
Sequence GGTCGAAGGCAGAGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103926472_1103926479 19 Left 1103926472 12:124426284-124426306 CCTTATAAGAAGAGGAGAAGCAC 0: 1
1: 0
2: 16
3: 138
4: 609
Right 1103926479 12:124426326-124426348 GGTCGAAGGCAGAGCATGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103926479 Original CRISPR GGTCGAAGGCAGAGCATGGA AGG Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
900494778 1:2971489-2971511 GGGAGGAGGCAGGGCATGGATGG - Intergenic
900754802 1:4426072-4426094 GGGAGGAGGCACAGCATGGAAGG - Intergenic
902372385 1:16014748-16014770 GATGGAAGCCAGGGCATGGATGG - Exonic
903594554 1:24484290-24484312 GGTGGAAGGCAGAGCAGGTGGGG - Intergenic
904435466 1:30492062-30492084 GGGCGTGGGCAGATCATGGAAGG + Intergenic
904918457 1:33987010-33987032 GGCCGATGGCACAGCAGGGATGG + Intronic
904963828 1:34356203-34356225 GGGCAAAGGCAGAGCAAGAATGG + Intergenic
905324747 1:37143385-37143407 GATTGAAGGGAGAGCAGGGAGGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907405464 1:54251176-54251198 AGTCGCAGGCAGAGCTAGGAAGG + Intronic
907670050 1:56466425-56466447 GGATGAAGGCAGAGCAGGAATGG - Intergenic
907703764 1:56815202-56815224 GGCAGAAGGGAGAGCATGGGCGG - Intronic
909745687 1:79094761-79094783 GATGGAAGGCACAGAATGGAGGG - Intergenic
912412959 1:109490576-109490598 TGGCTAAGGCAGGGCATGGAAGG + Intronic
914450455 1:147786952-147786974 GCTCAAAGGCAGAGCATGGCAGG + Intergenic
914920628 1:151844923-151844945 GGTAGAGTGCAGAGCATGGCAGG - Intergenic
915594424 1:156888086-156888108 GGCCAAAGGCAGAGCTGGGAGGG + Intergenic
918343793 1:183589062-183589084 GCTCTAAGGCAGAGCATGGCAGG - Intronic
918466628 1:184827395-184827417 TGTGGAAGGCAGACCATGGTAGG - Intronic
920655362 1:207870222-207870244 TGTCGAAGGCATACCATGTAAGG - Intergenic
923251038 1:232180052-232180074 GGGAGAAGGCAGAGCATCGCAGG - Intergenic
924554632 1:245108002-245108024 AGTCAAGGGGAGAGCATGGAGGG - Intronic
924834560 1:247635751-247635773 GGTCGAAGGAAGAACTGGGAAGG + Intergenic
1067031916 10:42884118-42884140 GGCCGAAGGCAGAGCCGGGCTGG + Intergenic
1068065260 10:52122146-52122168 GGTGGAAGGCAAAACATAGAAGG + Intronic
1069532659 10:69230535-69230557 GGTCCAAGGCAGTTCATGGAGGG + Intronic
1069594807 10:69663749-69663771 GGTCGAGGGCAGAGGGTGGAGGG - Intergenic
1071823498 10:89301402-89301424 GGTATAAGGCAGAGCAAAGATGG + Intronic
1073266618 10:102231528-102231550 GGTCGCAGGCTGAGCGCGGAGGG + Intronic
1073850645 10:107613467-107613489 GGTCTAACACAGAGCTTGGAGGG + Intergenic
1074765675 10:116698521-116698543 GGTAGGAGGCACAGCCTGGAGGG - Intronic
1074925736 10:118068540-118068562 GGGGGAAGGCAGAGAAAGGATGG - Intergenic
1074957785 10:118409360-118409382 GGTCAGAGGCAAAGGATGGAGGG + Intergenic
1075666978 10:124238411-124238433 GGTCCAAAGCAGGGCAGGGAAGG - Intergenic
1076888262 10:133272335-133272357 GGTGGAAGGGAGAGCAGGGCTGG - Intronic
1079389040 11:20005044-20005066 GCTCCAAGGCAGAGCAGGAACGG + Intronic
1080773575 11:35364951-35364973 GGTGGATGGCAGAGCAGGGCAGG + Intronic
1081054638 11:38394359-38394381 GGTAGAAAGGAGAGCATAGATGG - Intergenic
1081782493 11:45722812-45722834 GGCCAAAGGGAGAGCTTGGAGGG + Intergenic
1085036034 11:73300638-73300660 TTTGGAAGGCAGAGCAGGGAGGG + Intergenic
1085905820 11:80761188-80761210 GGTCCAAGACAGGGGATGGAGGG - Intergenic
1086248251 11:84781900-84781922 GGTCTAAGACAGAGGCTGGATGG + Intronic
1090423496 11:126591561-126591583 GGTGCAAGGCAGAGCATGGCTGG - Intronic
1091391597 12:129495-129517 GGTCGAAGGCAGAGGGAGAAGGG - Intronic
1091440947 12:511552-511574 GGTCGAAGGCGGAAGGTGGAAGG - Intronic
1091441028 12:511891-511913 GGTCGAAGGCGGAAGGTGGAAGG - Intronic
1091441137 12:512342-512364 GGTCGAAGGCGGAAGGTGGAAGG - Intronic
1091773503 12:3169175-3169197 GGAGGAAGACAGAGCATTGAAGG - Intronic
1093993950 12:25621531-25621553 GATCTAAGGCACAGCATGAATGG - Intronic
1095590063 12:43893054-43893076 TGTGGAAGGTAGAGCATGGAAGG + Intronic
1095926400 12:47583841-47583863 GGAGGAAGGCAGACCATGTAGGG + Intergenic
1096046451 12:48566868-48566890 GGGAAAAGGAAGAGCATGGACGG - Intergenic
1098049825 12:66441881-66441903 GGGAGAAGGAAGAGCATGAATGG - Intronic
1098365936 12:69703240-69703262 GGTGGAATGCAGAGGAAGGATGG + Intergenic
1101984464 12:109434770-109434792 GGACGGAGGCAGAGATTGGAGGG - Intronic
1103920040 12:124394612-124394634 AGACAAAGGCAGAGCCTGGAGGG + Intronic
1103926479 12:124426326-124426348 GGTCGAAGGCAGAGCATGGAAGG + Intronic
1110832718 13:80050097-80050119 GGTAGAAGCCTGTGCATGGATGG - Intergenic
1113590333 13:111494385-111494407 AGTGGATGGCAGGGCATGGAGGG + Intergenic
1114258818 14:21023587-21023609 GGTCCAGGGCAGAGGAGGGAGGG - Intronic
1118586720 14:67360219-67360241 GGACGAATGTAGATCATGGAAGG - Exonic
1119209597 14:72821192-72821214 GGTGGGAGGCAGAGCCTGGGAGG + Intronic
1119557765 14:75566837-75566859 GGTCGAAGGCAGAGGCCTGAAGG + Intergenic
1121221561 14:92289171-92289193 GGACGAAGACAGAGCATGGTGGG - Intergenic
1123194579 14:106604301-106604323 GGTAGAAGTCAGACAATGGATGG - Intergenic
1128877842 15:71216619-71216641 GTTCCAAGACTGAGCATGGAGGG + Intronic
1131467089 15:92664335-92664357 GGTGGAAGGCAGAGTAGGCAGGG + Intronic
1131869364 15:96745664-96745686 GGTTAGAGGCAGAGCATGAAGGG - Intergenic
1133830446 16:9318508-9318530 GGTGAAAGCCAGATCATGGAAGG - Intergenic
1134832640 16:17336115-17336137 GATGGAGGGCAGAGCGTGGAAGG + Intronic
1134844890 16:17431720-17431742 ATTCGAAGGCAGGCCATGGATGG + Intronic
1136287984 16:29255158-29255180 GGACGGAGGCAGAGCCTGGCGGG - Intergenic
1138056670 16:53841642-53841664 GGTCAAAGGCAGTGAAAGGAAGG - Intronic
1138282025 16:55779519-55779541 GGGTGAAGGCATAGCAGGGAGGG - Intergenic
1138434333 16:56988890-56988912 GGTAGGAGGGAGAGCAGGGAAGG - Intergenic
1139295220 16:65894923-65894945 GGCAAAAGGCAGATCATGGAGGG - Intergenic
1139470243 16:67174482-67174504 GGCCTAGGGCAGAGCAGGGACGG + Intronic
1142008238 16:87700566-87700588 GGTAGAAGGAAGAGGGTGGAGGG + Intronic
1203081001 16_KI270728v1_random:1146268-1146290 GGTCCAAGGCAGAGGGCGGATGG + Intergenic
1142746735 17:1963155-1963177 GGAGGAAGGCAGAGCTGGGATGG + Intronic
1144287214 17:13788404-13788426 GGTCAAAGGCAGGGCAGGCAAGG + Intergenic
1144765472 17:17730259-17730281 TGCCGAGGTCAGAGCATGGAAGG + Intronic
1145768998 17:27479078-27479100 GATGGAGGGAAGAGCATGGAGGG - Intronic
1145793809 17:27644221-27644243 GCACTTAGGCAGAGCATGGAAGG - Intronic
1147535878 17:41323192-41323214 GGTTGAAGGCAGAGGACAGAGGG - Intergenic
1147892773 17:43729062-43729084 GGTTGAAGGCAGGAAATGGATGG - Intergenic
1150651003 17:67010154-67010176 GGACAAAGGCAGAGCTTGGCTGG - Intronic
1151517790 17:74607583-74607605 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151517814 17:74607681-74607703 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1152307475 17:79529714-79529736 GCTCCAAGGCAGAGGAAGGAGGG + Intergenic
1152318424 17:79594455-79594477 TGTGGGAGGCAGAGCCTGGAGGG - Intergenic
1152528212 17:80901821-80901843 TGGGGAAGGCAGAGCAGGGAGGG - Intronic
1152723412 17:81933809-81933831 GGTCAAAGGCAGAGCCAGGCTGG - Intronic
1152741679 17:82021141-82021163 GGTGACAAGCAGAGCATGGACGG + Intronic
1203164760 17_GL000205v2_random:83753-83775 GGTCAAAGTTAGAGCCTGGAAGG + Intergenic
1153777070 18:8463568-8463590 GGAAGAAGGAAGAGCAGGGAAGG + Intergenic
1156219643 18:35038564-35038586 GGATGAAGGCAGAGCAAGGAAGG - Intronic
1156395063 18:36691798-36691820 GGAAGCAGGCAGAGCATGCAGGG - Intronic
1157186996 18:45549220-45549242 CACCGAAGGCAGAGCATTGATGG - Intronic
1161518015 19:4707521-4707543 GGTTGAAAGTAGAGCAAGGAGGG - Intronic
1161846960 19:6717181-6717203 GGCTGTAGGCAGAGCAGGGATGG + Intronic
1162559178 19:11406158-11406180 GGTCGGAGGCAGGGGCTGGAGGG - Intronic
1162810887 19:13163861-13163883 GCTCGAAGACAGTGCAGGGAAGG - Intergenic
1163122601 19:15227042-15227064 GGTCGAAGGCAGGGACAGGAAGG + Exonic
1165690036 19:37855966-37855988 GGACGAAGGCAGCGCCTGGGGGG - Intergenic
1167088530 19:47327420-47327442 GGTTGAAGGCAAAGAATGGGGGG - Intergenic
1168327185 19:55544460-55544482 AGTCCGAGGCAGAGCAGGGAGGG - Intronic
927154036 2:20211688-20211710 GGACGAAGGCTGGGCCTGGAAGG + Intronic
927249417 2:20984233-20984255 GGTGGATGGCAGGGGATGGATGG + Intergenic
928092503 2:28383798-28383820 GGTAGAAGTCAGGGCATGGTTGG - Intergenic
929322101 2:40556584-40556606 GGGCAAAGACAGAGCATGCAGGG - Intronic
930199618 2:48540527-48540549 GCACCCAGGCAGAGCATGGAAGG + Intronic
931997972 2:67857254-67857276 GGTCGAAGCCAGGGCTGGGAAGG - Intergenic
933057758 2:77694704-77694726 GGTGGGAGGCAGAGGATGGGTGG - Intergenic
935064106 2:99633354-99633376 GGACGATGGCAATGCATGGAGGG + Intronic
935082601 2:99813168-99813190 GGTTGCAGGCAGAGGTTGGAGGG + Intronic
935559489 2:104545434-104545456 GGCCCAAGGCAGAGAAGGGAAGG + Intergenic
937576860 2:123434117-123434139 GGTAGAAGCCAGATCATGTAGGG + Intergenic
938141537 2:128798724-128798746 TGTCAAAGGCGGAGTATGGAAGG + Intergenic
940987518 2:160063411-160063433 GGCAGAAAGCAGAGCCTGGAAGG + Intergenic
941010847 2:160297831-160297853 GCAGGAAGGCAGAGGATGGAGGG + Intronic
941639198 2:167969411-167969433 GGCCGAGGCCAGACCATGGAGGG - Intronic
944300016 2:198112920-198112942 GGCAGAAGGGAGAGAATGGATGG + Intronic
946352621 2:219165257-219165279 AGTCGAGGGCTGAGCCTGGAGGG - Exonic
946631729 2:221676929-221676951 GGTGGAAGTCCGAGCCTGGAAGG + Intergenic
948458667 2:238118836-238118858 GGTGGAAGGAAGAGGGTGGATGG + Intronic
948458765 2:238119218-238119240 GGTGGAAGGAAGAGGGTGGATGG + Intronic
948458768 2:238119232-238119254 GGTGGATGGAAGAGGATGGATGG + Intronic
948465752 2:238150886-238150908 GGCCGCTGGCAGGGCATGGAAGG + Exonic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1172495078 20:35375857-35375879 GGTAGGAGGCTGAGCCTGGAAGG + Intronic
1173494203 20:43507392-43507414 GCTCGAAGAGAGAGCCTGGAGGG - Intergenic
1175871979 20:62213236-62213258 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872013 20:62213321-62213343 GGGGGAAGGGAGAGCAAGGATGG + Intergenic
1175872070 20:62213456-62213478 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872104 20:62213541-62213563 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872141 20:62213628-62213650 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872178 20:62213715-62213737 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1176406997 21:6375334-6375356 GGTCAAAGTTAGAGCCTGGAAGG - Intergenic
1178340504 21:31782129-31782151 GGTAGAGGACAGAGCATGGTGGG - Intergenic
1178398423 21:32262885-32262907 GCTCGAAGGTAGAGAAGGGAGGG - Intergenic
1178755520 21:35345743-35345765 GGTCCAAGTCTGAGCATTGATGG + Intronic
1179251515 21:39674950-39674972 GGTGAAAGGCAGGGCATGGTGGG - Intergenic
1179478937 21:41665784-41665806 GAACTAAGGCAGAGCAGGGAGGG - Intergenic
1180019285 21:45111111-45111133 GGTGGAAGGCACAGCCTGGCGGG - Intronic
1180239744 21:46493902-46493924 AATCCAAGGCAGGGCATGGATGG - Intronic
1182069005 22:27450276-27450298 GGTTGAAGTCAGAGAAGGGAAGG - Intergenic
1182963594 22:34501106-34501128 GGTCAGAGGCAGAGCAGGTAAGG + Intergenic
1183484101 22:38080218-38080240 AGGTGAAGGCACAGCATGGATGG - Intronic
1184470530 22:44693060-44693082 GGTCAAAGCCAGAGCCTGGCAGG + Intronic
1184667385 22:45996233-45996255 CGCCGAAGGCAGATCAGGGAGGG + Intergenic
1185148004 22:49149755-49149777 GGAGGAAGGCAGAGGAGGGAAGG + Intergenic
951293392 3:20902065-20902087 TGTCGAAGGTAGAGCCTGGTTGG + Intergenic
952101678 3:30020453-30020475 GGGAGAAGGCAGAGCCTGGGAGG - Intergenic
955805158 3:62726068-62726090 GACCAAAGGCAGAGCATAGAAGG + Intronic
957011592 3:75012000-75012022 TGTTGAAGGCAGAGCCTGGTGGG + Intergenic
961408382 3:126699645-126699667 GATCGAATGCACAGCATGGATGG - Intergenic
963236933 3:142964592-142964614 AGTCAAAGGCTGATCATGGAGGG + Intronic
967111136 3:186294992-186295014 GATGGAAAGCAGAGCATGGTTGG - Intronic
967187534 3:186958003-186958025 GGTTGAAGGAGGAGAATGGAAGG + Intronic
969269138 4:6086843-6086865 GGACGGAGGCAGAGGCTGGAGGG + Intronic
969563867 4:7966369-7966391 GGAGGAACGCAGCGCATGGAGGG + Exonic
969926981 4:10594276-10594298 GATGGAAGGCAGAGGATGGGGGG - Intronic
970456196 4:16226490-16226512 GGCCGGAGGCAGAGGCTGGAGGG - Exonic
974010091 4:56598724-56598746 GGCAGAAGGCAGATCATGTAGGG + Intronic
976733440 4:88286475-88286497 GGAAGAAGGCAGTGCCTGGAAGG - Intergenic
976845780 4:89487514-89487536 GGGAGAAGGCAGAGCTTGCAGGG + Intergenic
981227886 4:142318269-142318291 AGTGGAAGGCAGAGGAAGGAAGG + Intronic
981578038 4:146225486-146225508 GGGCAAAGGCAGAGAATGGAGGG - Intronic
982834254 4:160103750-160103772 GTTCTAAGGCAGATTATGGAGGG + Intergenic
985852368 5:2398002-2398024 GGTCGAAGGCAGGGCCAGGCTGG - Intergenic
986051181 5:4091803-4091825 AGTTGAAGGCGAAGCATGGAAGG - Intergenic
986303876 5:6501211-6501233 AGTGGAATGCAGAGGATGGACGG + Intergenic
987043175 5:14082430-14082452 GGCAGAAGTCAGAGCATGGAGGG - Intergenic
988503394 5:31801554-31801576 GGTAGAAGGAAGATCAGGGAGGG + Intronic
989385722 5:40853181-40853203 GATAGAAGGAAGAACATGGAGGG + Exonic
989519792 5:42388053-42388075 AATAGAAGGCAGAGCATGGGTGG - Intergenic
991057267 5:62334439-62334461 GGTAGTAGGCAGGGCATGGTGGG - Intronic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
998101914 5:139441440-139441462 GGAGGAAGGCATAGCAGGGAAGG + Intronic
998348944 5:141488413-141488435 GGTCAGAGGCCAAGCATGGATGG - Intronic
999153203 5:149440508-149440530 GGGCCAAGGCAGTGCAGGGAAGG - Intergenic
1000197312 5:158972216-158972238 GGTAGATGGAAGAGCAGGGAGGG - Intronic
1000286740 5:159833420-159833442 GCTGGAAGGCAGGGAATGGAGGG - Intergenic
1008109695 6:47478389-47478411 GGTGGAAGGCAGGGCAAGAAGGG - Intronic
1008764256 6:54892016-54892038 TGTAGAGGGCAGAACATGGATGG - Intronic
1008777016 6:55052152-55052174 GGTAGAAGGCAGAGAGGGGAAGG - Intergenic
1010020585 6:71155280-71155302 GATCCAAGGCAGAGAAAGGAAGG - Intergenic
1010152437 6:72749588-72749610 AGTGGAAGGCAGAGCATGGCAGG - Intronic
1011352319 6:86435890-86435912 GGTTGAAGGGAGAGAATGGCTGG + Intergenic
1015138448 6:129901485-129901507 AGTCAAAGGCAGAGATTGGAAGG - Intergenic
1015155737 6:130093825-130093847 TGTAGAAAGAAGAGCATGGAGGG + Intronic
1016186769 6:141207000-141207022 GGACTGAGGTAGAGCATGGAAGG - Intergenic
1017334798 6:153243497-153243519 GATGGAAGGTAGAGCCTGGAAGG - Intergenic
1018648311 6:165968830-165968852 GGCAGAAGGCAGAGCCTGTAGGG + Intronic
1019390365 7:783415-783437 GGTCGCACGCAGAGCATGCCCGG - Intronic
1022046119 7:26623918-26623940 GGCTGAGGCCAGAGCATGGAAGG - Intergenic
1026183245 7:68060825-68060847 GGACGGAGGCAGAGAGTGGAGGG + Intergenic
1026493163 7:70880526-70880548 TGTTGAAGGCAAAGCATGAAAGG - Intergenic
1029259715 7:99293546-99293568 GGTCTAAGCCAGGGAATGGAGGG - Intergenic
1029615062 7:101651102-101651124 GGTCAAAGGCAGAACATGGTGGG + Intergenic
1031580996 7:123474964-123474986 GGTGAAAGGCAGAGAATTGAGGG - Intronic
1034166838 7:149031422-149031444 GGTAGAAGGCGGAACATGGAAGG - Intergenic
1034647492 7:152661699-152661721 AGCAGAAGTCAGAGCATGGAAGG + Intronic
1034936373 7:155203250-155203272 GGGCCAAGGGAGAGCAGGGAGGG - Intergenic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1039734991 8:40322238-40322260 TGTGGAAGGCAGAGCAGAGATGG + Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1044039204 8:87344765-87344787 GGTCAAAGGAAGTACATGGATGG - Intronic
1046629521 8:116609469-116609491 GGTCAAAGTCAGAGAAGGGATGG - Intergenic
1047893013 8:129333811-129333833 GGAAGAAGGGAGGGCATGGAGGG + Intergenic
1047936034 8:129779447-129779469 ACTGGAAGGTAGAGCATGGAGGG + Intronic
1050636089 9:7614698-7614720 GGGAGAAGCCAGAGCAGGGAAGG - Intergenic
1051589693 9:18764612-18764634 GATCAAAGGCAGAGCAGAGAAGG + Intronic
1051741480 9:20256599-20256621 GCTTGATGGCAGAGCATGTAAGG - Intergenic
1055815126 9:80195862-80195884 GTTGGAAGGCAGAACAAGGAAGG - Intergenic
1059482807 9:114604961-114604983 GCCTGAAGGCAGAGCATGGTAGG - Intergenic
1060756409 9:126217625-126217647 GGGAGAAGGCTGAGCAGGGAAGG + Intergenic
1061621063 9:131811711-131811733 GGTTGGAGGCAGAGCACGGAGGG - Intergenic
1062322394 9:135996802-135996824 GCTGGAAGCCAGAACATGGAGGG - Intergenic
1062608091 9:137357335-137357357 GGAAGAAGGGAGAGCAGGGAAGG - Intronic
1187214387 X:17262319-17262341 GGAGAAAGGCAAAGCATGGAAGG - Intergenic
1187956465 X:24523576-24523598 GGTCTAAGAAAGAGCATGGAGGG + Intronic
1188029263 X:25246393-25246415 TGTGGAAGGAAGGGCATGGAAGG + Intergenic
1189383801 X:40520573-40520595 GGCAGAAGGCAGGGGATGGAAGG + Intergenic
1189949443 X:46213756-46213778 GGAGGAAGACAGAGCAAGGAGGG + Intergenic
1190289643 X:48983737-48983759 GGTTGAAGGGAGAGGATGGGGGG - Intronic
1191961528 X:66708059-66708081 GGTAAAAGGCAAAGCATTGATGG - Intergenic
1192055155 X:67766408-67766430 GGTGGGAGGCGGAGCATGGAGGG - Intergenic
1194640591 X:96399372-96399394 GGCAGAAGCCAGATCATGGACGG - Intergenic
1196972773 X:121127440-121127462 GGATGAAGCCAGATCATGGAGGG - Intergenic
1197377405 X:125698452-125698474 ACTTGAAGGTAGAGCATGGAAGG - Intergenic
1199257368 X:145732186-145732208 GGTTGAAGCCAGAGTATTGAGGG - Intergenic
1200052637 X:153443075-153443097 GGGCAGAAGCAGAGCATGGAGGG - Intergenic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic