ID: 1103926604

View in Genome Browser
Species Human (GRCh38)
Location 12:124426865-124426887
Sequence GTCCCCTCTGTGTCTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 454}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103926604_1103926608 -1 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926608 12:124426887-124426909 CGGATGGTCTGCGCCAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 87
1103926604_1103926609 0 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926609 12:124426888-124426910 GGATGGTCTGCGCCAGAGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 116
1103926604_1103926612 23 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926612 12:124426911-124426933 AAAACGCGAAACCAAGGAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1103926604_1103926611 17 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926611 12:124426905-124426927 GCAGGGAAAACGCGAAACCAAGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103926604 Original CRISPR GTCCCCTCTGTGTCTTCCCT GGG (reversed) Intronic
900126241 1:1070156-1070178 CTCCCTTCTGTGTCTTCGCTGGG + Intergenic
900167746 1:1250612-1250634 GTGCCCTCGGTCTCTTCCCTCGG + Intergenic
900271372 1:1791002-1791024 GCTCCCTCTGTGCCCTCCCTTGG + Intronic
900664060 1:3801902-3801924 GTGCCCTCAGTCTCTTGCCTCGG + Intergenic
901806317 1:11740864-11740886 CTTCCCTCTGTCTCTTTCCTCGG + Intronic
901861831 1:12079461-12079483 CTCCCCTCTCTCTCTTCCCCAGG + Intronic
903385502 1:22923655-22923677 GCCTTCTCTGTGTCTTCACTTGG - Intergenic
903666496 1:25010879-25010901 CTTCCCGCTGTGTCTTCACTTGG - Intergenic
904430693 1:30462194-30462216 GTGCCCTCTGTGTCTTCTTGGGG + Intergenic
904825341 1:33270715-33270737 CTACCCTCTGGGTCTGCCCTGGG + Intronic
904829296 1:33296401-33296423 TGTCCCTCTGTGTCCTCCCTGGG + Intronic
905835527 1:41117091-41117113 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
907552245 1:55314354-55314376 GTCCCCTCTGTGCCTGCCACTGG + Intergenic
909486224 1:76177576-76177598 TTCCCATCCGTGCCTTCCCTAGG + Intronic
911718721 1:101166502-101166524 TTCTCCTCTGATTCTTCCCTTGG - Intergenic
911958144 1:104263604-104263626 GTGTCCTCTGTCTCTTGCCTTGG + Intergenic
912709847 1:111942495-111942517 GTCCCCACTGGCTGTTCCCTTGG - Intronic
915106993 1:153540917-153540939 GCTCCATCTGTCTCTTCCCTTGG - Intronic
915233234 1:154461712-154461734 GTGCCTTCAGTGTCTTGCCTCGG + Intronic
916438111 1:164795343-164795365 GTCCTCTCTGTTACTTCCTTGGG + Intronic
916891012 1:169112480-169112502 GTCCCTTCTCTGCTTTCCCTTGG + Intronic
917527467 1:175801773-175801795 GTCCTCCCTGTGTCTTCACACGG + Intergenic
919116974 1:193292536-193292558 GGCCCATCTTTATCTTCCCTTGG - Intergenic
919800270 1:201349859-201349881 GTCCCCACTCAGCCTTCCCTGGG - Intergenic
920299324 1:204978778-204978800 GTCTCCTCTTTGTTTTCCCTTGG + Intronic
920318216 1:205095461-205095483 GTCCAATCTTTGACTTCCCTGGG - Intronic
920564225 1:206960791-206960813 ACCCCCTCTATGTCCTCCCTTGG + Exonic
921183147 1:212647054-212647076 CTCCCATCAGTGTCATCCCTGGG + Intergenic
922213435 1:223502278-223502300 GCCCTCTTTGTCTCTTCCCTGGG - Intergenic
922875378 1:228936247-228936269 TTCTCCTCTGATTCTTCCCTTGG - Intergenic
922892531 1:229072795-229072817 GCCCCCACTGTGTCTGCCCAAGG + Intergenic
923661115 1:235958197-235958219 TTCTCCTCTGATTCTTCCCTTGG + Intergenic
924740153 1:246790165-246790187 GCCCCCTCAGTGACCTCCCTCGG - Intergenic
1062871926 10:912199-912221 GTCCAATCTTTGGCTTCCCTGGG + Intronic
1062986485 10:1773705-1773727 TTCTCCTCTGGTTCTTCCCTTGG - Intergenic
1063010960 10:2020991-2021013 TTCCCCTCTGTGTCCTCACAGGG - Intergenic
1063248845 10:4252222-4252244 CTCCCTTCTGTGTTTCCCCTAGG + Intergenic
1063327704 10:5121600-5121622 GGGCCCACTGTGACTTCCCTAGG + Intronic
1063341959 10:5274318-5274340 GGGCCCACTGTGACTTCCCTAGG + Intergenic
1064838027 10:19556565-19556587 GTCCCCTCTCTGTCTTTTCATGG + Intronic
1065265492 10:23971099-23971121 TTCTCCCCTGAGTCTTCCCTTGG + Intronic
1069071859 10:63997893-63997915 GTCATCTCTGTCTCTTCCATGGG - Intergenic
1069557429 10:69407337-69407359 GGGTCCTCTGTGTCTGCCCTCGG - Intronic
1069725520 10:70575422-70575444 GCTCCCTCTGTGTCCTCCATAGG + Intergenic
1069811304 10:71161927-71161949 GTCCCCTCTCTCTCCTTCCTGGG - Intergenic
1069957575 10:72061384-72061406 GGCCCCTCTGAGGATTCCCTAGG - Exonic
1070320518 10:75351551-75351573 ACCCCATCTGTATCTTCCCTGGG - Intergenic
1071391923 10:85183974-85183996 GTCCCCTATGTGGCTTGCTTTGG + Intergenic
1071829003 10:89353449-89353471 TTCTCCCCTGTTTCTTCCCTTGG - Intronic
1073200873 10:101734253-101734275 CTCCCCTCTGTTCCATCCCTAGG - Intergenic
1074721958 10:116271940-116271962 TTACCCTCTGAGTCTTTCCTAGG - Intronic
1075835014 10:125445557-125445579 GTCCCTTCTCTGGCTTCCCACGG + Intergenic
1075922929 10:126227958-126227980 GTCCCCACTGTCTCCTCCCTAGG - Intronic
1076862263 10:133143773-133143795 GTGCCCTCCGTCTCTTGCCTCGG - Intergenic
1076894726 10:133304613-133304635 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
1077264927 11:1643693-1643715 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1077271000 11:1681067-1681089 CTCCACTCTCTCTCTTCCCTGGG - Intergenic
1077388396 11:2286847-2286869 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1077445546 11:2589024-2589046 TTCCCCTCAGAGTCTTCCCAAGG + Intronic
1077520027 11:3027470-3027492 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
1077648836 11:3951327-3951349 GGCCCCTCTTTGTCTTTTCTTGG - Intronic
1080826622 11:35853995-35854017 GTCCCCTCTGTCTCCTGCCTTGG + Intergenic
1081622160 11:44624986-44625008 CTCCCCTCTGTGGGCTCCCTTGG - Intergenic
1081937371 11:46914531-46914553 GTCAGCACTGAGTCTTCCCTGGG + Intronic
1082580005 11:54854964-54854986 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1083987679 11:66227140-66227162 CTCCCCTCTATGTCCTTCCTGGG + Intronic
1084013890 11:66367634-66367656 GGCCCCTCAGTGTCTTCTCTGGG + Intronic
1084217782 11:67659868-67659890 GTGCCCTCAGTCTCTTGCCTTGG + Intergenic
1084653935 11:70504445-70504467 GGCCCCACTGAGTCCTCCCTGGG - Intronic
1084693712 11:70741597-70741619 GTACCCTGTGTGTCCTCCCCAGG + Intronic
1086767851 11:90720982-90721004 GTTTCCTCTGTGTCTTCTCATGG - Intergenic
1089380083 11:118023704-118023726 TTCCCCTCTATGTCTCACCTTGG - Intergenic
1089776910 11:120844140-120844162 TTTCCCTCTCTGTCTGCCCTGGG - Intronic
1090345422 11:126065363-126065385 GACCTCTCTGTGTCCTCCCACGG - Intergenic
1091042249 11:132292623-132292645 GTCTCCTCTGTGTCTGCTGTAGG - Intronic
1092091206 12:5805104-5805126 GTCCCCTCTCTGCCTGCCCAGGG - Intronic
1092192288 12:6529673-6529695 GCCCCCACTGTGGCATCCCTGGG + Intronic
1092448957 12:8584378-8584400 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1092714046 12:11369757-11369779 CTCCCCTCTGCTCCTTCCCTCGG - Intronic
1092717755 12:11408790-11408812 CTCCCCTCTGCTCCTTCCCTCGG - Intronic
1095232315 12:39754105-39754127 TTCCCCTCTATGTCCTCCTTTGG - Intronic
1096550755 12:52370163-52370185 GTGTTCTCTGTGTCCTCCCTGGG - Intergenic
1096673285 12:53213045-53213067 GTCCCCTCTCTGTCTTCCCAGGG - Intronic
1097089881 12:56496594-56496616 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1097090629 12:56501678-56501700 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1098935426 12:76473330-76473352 GTGCCCTCGGTCTCTTGCCTGGG + Intronic
1101390404 12:104294628-104294650 GTGTCCTCTGTCTCTTGCCTCGG + Intronic
1102255511 12:111412445-111412467 GGCCCCCCTGTGGCTTCCCATGG + Intronic
1103926604 12:124426865-124426887 GTCCCCTCTGTGTCTTCCCTGGG - Intronic
1104074504 12:125377308-125377330 TTCCTCTCTGGGTCTCCCCTTGG - Intronic
1104666378 12:130650078-130650100 GTCCCCACTGCGTCTCCCCGAGG - Intronic
1104871548 12:132001977-132001999 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1105020029 12:132809839-132809861 GTGTCCTCTGTCTCTTGCCTCGG + Intronic
1105041349 12:132963854-132963876 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1105287067 13:19013052-19013074 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1105459240 13:20567921-20567943 GTCCAATCTTTGGCTTCCCTGGG + Exonic
1105602183 13:21897321-21897343 GGCCTCTCTGGCTCTTCCCTTGG - Intergenic
1106096841 13:26653829-26653851 GTCCACTCGGTGTCTTCACTTGG + Intronic
1107469755 13:40681141-40681163 GACCCCTGTATCTCTTCCCTAGG + Intergenic
1107835591 13:44410205-44410227 AGCCCCTCAGAGTCTTCCCTGGG + Intergenic
1108764572 13:53611323-53611345 GTCACCTCTTTGACTTTCCTTGG + Intergenic
1109058629 13:57583276-57583298 GTCCCCTCCATTTGTTCCCTAGG + Intergenic
1109290843 13:60473483-60473505 GTGCCCTCGGTCTCTTGCCTTGG - Intronic
1109669400 13:65585391-65585413 GTACCCTGTATGGCTTCCCTTGG - Intergenic
1110145420 13:72184811-72184833 CTCCCATCTTTGGCTTCCCTGGG + Intergenic
1113823105 13:113229572-113229594 GTCCCGTTTGTGTCTTCCGCAGG + Intronic
1113927714 13:113950769-113950791 GTCTCTCCTGTGTCTCCCCTGGG - Intergenic
1114528624 14:23381461-23381483 GCCCCCTCCCTGTCTTCCCCAGG - Intergenic
1114617933 14:24078020-24078042 GGCCCCTCAGTGACTTCCTTGGG + Exonic
1114658045 14:24327823-24327845 GTGTCCTCTGTCTCTTGCCTCGG - Intronic
1116171944 14:41414058-41414080 GTGCTCTGTGTTTCTTCCCTTGG + Intergenic
1117021311 14:51573549-51573571 TTCCTTTCTGTGCCTTCCCTGGG - Intronic
1117073247 14:52075103-52075125 CTCCCCTCTGTGTTTTTGCTTGG - Intergenic
1117980618 14:61339238-61339260 GTCCCCTCTGTGTTCTCCCTGGG + Intronic
1121313379 14:92946993-92947015 GCCTCCCCTGTGTCCTCCCTGGG - Intronic
1121631810 14:95426627-95426649 GTGCCCTCGGTCTCTTTCCTCGG - Intronic
1121711471 14:96041902-96041924 TTCCCCTCTGTGTCTTAGCCGGG - Intronic
1122756064 14:103981085-103981107 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1123183578 14:106492325-106492347 GTGCCCTCGGTCTCTTACCTTGG + Intergenic
1126061278 15:44785136-44785158 GTGCCCTCGGTCTCTTGCCTTGG + Intergenic
1129387529 15:75203933-75203955 GGCCCCTCTGTGTCTTCTCTAGG + Intronic
1129689512 15:77705395-77705417 GTGACCTCAGTGTCTCCCCTTGG - Intronic
1129921187 15:79320450-79320472 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1130215033 15:81959990-81960012 TTACCCTGTGTCTCTTCCCTGGG + Intergenic
1130958686 15:88645383-88645405 GTCCCCTCTCCGACTTCTCTTGG + Intronic
1131705355 15:94989353-94989375 GTGCCATCTGTATATTCCCTTGG - Intergenic
1132046282 15:98565589-98565611 GTGCCCACTGTGGCTCCCCTGGG + Intergenic
1132380528 15:101362911-101362933 GTCCCATCTCTGTCCTCCCCAGG - Intronic
1132584931 16:701981-702003 GTGGCCTCTGTGTCCTCCCCAGG + Intronic
1132966891 16:2661241-2661263 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1132968027 16:2670491-2670513 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1133059683 16:3166384-3166406 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1135600798 16:23781877-23781899 TGGCCCTCTGTGTCTTGCCTTGG + Intergenic
1135670984 16:24375354-24375376 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1136191269 16:28616344-28616366 GTGTCCTCTGTCTCTTGCCTCGG + Intronic
1136270920 16:29147813-29147835 GTCCACGCTGTCTCCTCCCTGGG + Intergenic
1136275916 16:29179554-29179576 CTCCCCTCTCTGGCTCCCCTAGG + Intergenic
1136319123 16:29471016-29471038 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1136352779 16:29722047-29722069 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1136433694 16:30210360-30210382 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1137229862 16:46554292-46554314 GTGCCCTCGGTCTCTTGCCTTGG - Intergenic
1137754721 16:50892287-50892309 GACCCCTTTGTGTCATCCCGTGG - Intergenic
1138029087 16:53545387-53545409 GTCCAATCTTTGGCTTCCCTGGG - Intergenic
1138206051 16:55126012-55126034 GTCCTCTCTGATTCTTCCTTTGG + Intergenic
1138592040 16:58005697-58005719 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1138822516 16:60278728-60278750 CTCTCCACTGTGTCTTCCTTAGG - Intergenic
1139440681 16:66965113-66965135 GTTCCCACTGTGGCTTCCCCTGG - Intronic
1142074487 16:88109515-88109537 GTCCACGCTGTCTCCTCCCTGGG + Intronic
1142074534 16:88109837-88109859 GTCCACGCTGTCTCCTCCCTGGG + Intronic
1142368984 16:89667480-89667502 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1142384232 16:89752478-89752500 GTGTCCTCTGTCTCTTGCCTTGG - Intronic
1142415386 16:89938453-89938475 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1142752501 17:1997596-1997618 GTCCCCTCTAGGTATTCCCCAGG + Intronic
1143104157 17:4520041-4520063 TGCCCCTCAGTGTCTTCCCTTGG - Intronic
1143328558 17:6117858-6117880 GTGTCCTCTGTGTCTTCCATGGG + Intronic
1143783498 17:9241220-9241242 GCAGCCTCTGTGCCTTCCCTTGG - Exonic
1144468031 17:15512425-15512447 GTCCCCTTTGTGTCTTCTTATGG - Intronic
1144504124 17:15815731-15815753 ATCCCCTCTGTGCCTTGCTTGGG + Intergenic
1144633868 17:16891360-16891382 ATCCCCTCTGTGCCTTCCTTGGG + Intergenic
1144638040 17:16923499-16923521 GTCCCCTCTGTGGTCACCCTGGG + Intergenic
1144647434 17:16984968-16984990 GCCTCCTCTGTGTCTCCTCTAGG + Intergenic
1144780440 17:17805634-17805656 GAGTCCTCTGTGTCCTCCCTGGG - Intronic
1145731927 17:27197438-27197460 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1146761182 17:35480843-35480865 GTGCCCTCAGTCTCTTGCCTTGG - Intronic
1147759416 17:42787878-42787900 GTCCCATCTCTGCCTGCCCTCGG + Exonic
1148401071 17:47362090-47362112 GTGCCCTCAGTCTCTTGCCTCGG - Intronic
1148710354 17:49676342-49676364 GTTCCCTGTGTGTCATCTCTTGG + Intronic
1149413813 17:56436973-56436995 TTTCCCTCTGTGTATTTCCTTGG - Intronic
1149720571 17:58840073-58840095 GTCCCATGTGCTTCTTCCCTTGG - Intronic
1150886329 17:69090527-69090549 GTGCCTTGTGTGTCCTCCCTTGG + Intronic
1151369549 17:73639333-73639355 GTCCCCTCTCTCCCTTCCCCCGG + Intronic
1151450556 17:74195995-74196017 GTCCCCTCTGTGTCCTGCCTAGG - Intergenic
1153387697 18:4516803-4516825 CTGCCCTCTGTGTCTTCACATGG - Intergenic
1155011626 18:21784450-21784472 GTGCCCTCGGTCTCTTGCCTTGG - Intronic
1155416858 18:25607420-25607442 GCCCCCTCTCTCTCTACCCTGGG - Intergenic
1156581306 18:38379747-38379769 GCCACCTCTGTGTCTCTCCTGGG + Intergenic
1157551129 18:48582520-48582542 GTCCCCTCTGTGTTTCACGTGGG + Intronic
1157969275 18:52247705-52247727 GTCTCCTCTGAGTGGTCCCTGGG + Intergenic
1158440150 18:57468164-57468186 GTCCACCCTGTCTCTGCCCTTGG + Intronic
1159054677 18:63452000-63452022 TTCCCCTGTGATTCTTCCCTTGG - Intergenic
1159054843 18:63453334-63453356 TTCCCCTGTGATTCTTCCCTTGG + Intergenic
1159068247 18:63593217-63593239 GTCCCCTCACTGGCTCCCCTTGG - Intronic
1160090883 18:75825633-75825655 GACTCCTGTGTGTCTGCCCTGGG - Intergenic
1161142682 19:2657784-2657806 GTGCCCTCAGTCTCTTGCCTCGG - Intronic
1161280175 19:3441663-3441685 GGCCCCTCTGGCCCTTCCCTTGG - Intronic
1161431397 19:4234373-4234395 GTCCCCTCTGTGGCAGCCCCAGG + Intronic
1161696188 19:5769700-5769722 CTCCCCTCTGTGTCCTCCGCAGG - Intronic
1161738824 19:6007914-6007936 CTCCTCTCTGTGGCCTCCCTTGG - Intronic
1161753805 19:6116772-6116794 GTCTCCTCGCTGTCTGCCCTGGG - Intronic
1161834136 19:6633672-6633694 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1162008207 19:7793596-7793618 GTGCCCTCGGTCTCTTGCCTTGG + Intergenic
1162089376 19:8268958-8268980 GTGCCCTCAGTCTCTTGCCTCGG - Intronic
1162224113 19:9205408-9205430 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1162236251 19:9311967-9311989 GTGCCCTCGGTCTCTTGCCTTGG - Intergenic
1162382683 19:10340736-10340758 GTCCCCTTGGCGCCTTCCCTTGG - Intergenic
1162638686 19:11990172-11990194 GTGCCCTCTGTCTCTTGCCTTGG + Intergenic
1162729887 19:12711928-12711950 GTGTCCTCTGTCTCTTGCCTCGG - Intronic
1163075715 19:14889276-14889298 GTGCCCTCGGTCTCTTGCCTTGG + Intergenic
1163152575 19:15424064-15424086 GTCGCCTCAGTGGCTGCCCTTGG - Intronic
1163465592 19:17466695-17466717 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1163471414 19:17499494-17499516 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1163492189 19:17623485-17623507 GTCCTCTCTGTGTCTGGACTCGG - Intronic
1163495831 19:17646109-17646131 ATGCCCTCTGTGTCTTCCAGTGG - Exonic
1164955247 19:32377570-32377592 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1165016628 19:32885977-32885999 GTCCCTTCTATTTCTTCCCTGGG + Intronic
1165106124 19:33470525-33470547 ATCCCTTCTCTGTGTTCCCTGGG + Intronic
1165409130 19:35648090-35648112 ATCACCTCTGTGTCTTCACTCGG - Intergenic
1165993940 19:39831823-39831845 GTCCCTTCTCTGGCTTCCCAGGG - Exonic
1166310497 19:41959649-41959671 GTCCCCATTGTGCCTTCCCTGGG - Intergenic
1166446885 19:42865912-42865934 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
1166472220 19:43088200-43088222 GTTCCCTCAGTCTCTTGCCTCGG + Intronic
1166483360 19:43192149-43192171 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1166915074 19:46189887-46189909 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1167139264 19:47638269-47638291 GTCCCTTCTGTCCCTCCCCTGGG - Intronic
1167369785 19:49073651-49073673 CTCCCCTTTGGGTCTCCCCTTGG + Intergenic
1167369979 19:49074758-49074780 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1167392948 19:49208726-49208748 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
1167518983 19:49940917-49940939 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
1167591928 19:50408934-50408956 GGCCCATCTGGGCCTTCCCTTGG + Intronic
1167707668 19:51091184-51091206 CCCCCGTCTCTGTCTTCCCTTGG + Intergenic
1167719657 19:51169762-51169784 GTGCCCTCAGTCTCTTGCCTCGG + Intergenic
1167731250 19:51258028-51258050 CTGCCCTGTATGTCTTCCCTTGG + Intronic
1167979050 19:53257623-53257645 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1168131572 19:54323341-54323363 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1168215199 19:54920117-54920139 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
925298014 2:2791091-2791113 GTCCCGTGTGTGTTTTCCATGGG - Intergenic
925406926 2:3611904-3611926 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
925406934 2:3612033-3612055 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
925953368 2:8937067-8937089 CACCCCTCTGCTTCTTCCCTGGG + Intronic
927581014 2:24247378-24247400 GCCCCATGTGTCTCTTCCCTTGG + Intronic
928289689 2:30026407-30026429 GTCCCCTCTCTGACTTCACCTGG - Intergenic
928411896 2:31060748-31060770 GGCCCCTCACTGGCTTCCCTTGG - Intronic
929818486 2:45255321-45255343 GTCTCCTCTGTCCCTTCCCTTGG - Intergenic
930206096 2:48587836-48587858 AGCCCCACTGTGTTTTCCCTGGG - Intronic
930813587 2:55568934-55568956 GTGCCCTCAGTCTCTTGCCTCGG - Intronic
931048028 2:58379283-58379305 ATACTCTCTGTGTCTTACCTGGG + Intergenic
931964066 2:67514148-67514170 GTCTCCTTTCTGTCTTCCATAGG - Intergenic
932342877 2:70977822-70977844 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
932418948 2:71590183-71590205 GGCACCTCTGTTTTTTCCCTTGG + Intronic
933968255 2:87448210-87448232 CTCCCCTCTGCCTCTGCCCTGGG - Intergenic
934546975 2:95225929-95225951 GTCCACTCTGTGGCTTTCCTGGG + Intronic
935716490 2:105943721-105943743 ATCCCCTCAGAATCTTCCCTGGG + Intergenic
936140535 2:109936231-109936253 CTCCTCTCTGTGTCTTCACACGG - Intergenic
936177226 2:110234176-110234198 CTCCTCTCTGTGTCTTCACACGG - Intergenic
936204159 2:110435255-110435277 CTCCTCTCTGTGTCTTCACACGG + Exonic
936325542 2:111502294-111502316 CTCCCCTCTGCCTCTGCCCTGGG + Intergenic
936388178 2:112049159-112049181 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
937352509 2:121175123-121175145 GTGCCCTCTTTGTGTTCCCCCGG - Intergenic
938228243 2:129636180-129636202 GTCACCTCTGTGTCCTCACATGG + Intergenic
938960090 2:136333033-136333055 TTCCCCTCTGAGTCTCCCCAGGG - Intergenic
939225434 2:139358154-139358176 CCCCTCTCTGTGTGTTCCCTTGG + Intergenic
939345794 2:140964796-140964818 GTGTCCTCTGTCTCTTGCCTCGG + Intronic
942596338 2:177594889-177594911 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
942605169 2:177683057-177683079 GGCTCCTCTGTGTCTGGCCTGGG + Intronic
943084379 2:183294942-183294964 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
945097158 2:206230807-206230829 GTCCCCTTTGTGTCTTACTGAGG - Intergenic
946151661 2:217777725-217777747 GTCACCACTGTGTCATTCCTAGG - Intergenic
947625888 2:231618509-231618531 GTCTCATCTGTGGCTTCACTGGG - Intergenic
947749427 2:232524901-232524923 GGGCCCTCTGCATCTTCCCTGGG - Intronic
948005622 2:234605406-234605428 GTCTCCTCTGATGCTTCCCTTGG - Intergenic
948162341 2:235835125-235835147 GTGCCCTCAGTGTGTTCCCCGGG + Intronic
948540418 2:238687418-238687440 GTCTCCTCTGTGTCATAGCTTGG - Intergenic
948813058 2:240494846-240494868 GTGCCCTCTGTCTCTTGCCTCGG - Intronic
949046800 2:241876244-241876266 GTGTCCTCGGTGTCTTGCCTCGG + Intergenic
949048220 2:241881967-241881989 GTGCCCTCTGCGCCTTCACTGGG + Intergenic
1168864684 20:1075503-1075525 GTCCCATCTGAGGCTTGCCTGGG + Intergenic
1169071180 20:2731564-2731586 GAACCCTCTGAGTCTTACCTAGG - Intronic
1169295579 20:4394560-4394582 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1169388484 20:5170539-5170561 TCCTCCTCTGTGTCTTCCCCAGG + Intronic
1170604193 20:17863646-17863668 GTCCCTGCTGTGTGCTCCCTGGG + Intergenic
1170958101 20:21000276-21000298 ATCCCCTTCCTGTCTTCCCTAGG - Intergenic
1172093567 20:32449824-32449846 GTCCCCTCTGCGTCATGCTTGGG + Intronic
1172352665 20:34255480-34255502 GTGCCCTCGGTCTCTTGCCTTGG - Intronic
1172358831 20:34298194-34298216 GTGTCCTCTGTCTCTTGCCTCGG - Intronic
1172971439 20:38875747-38875769 GTCCCCACTGTCTCTACCCCCGG - Intronic
1172982241 20:38952194-38952216 TCCTCCTCTGTGTCTTCCCAAGG + Exonic
1173501225 20:43555424-43555446 ATCCCCTTTGTCTCTTTCCTTGG - Intronic
1175278775 20:57788763-57788785 CTGCCCTCTGTGACTTCACTCGG + Intergenic
1175501339 20:59453184-59453206 TACCCCTCCTTGTCTTCCCTGGG + Intergenic
1176007369 20:62873573-62873595 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1176154888 20:63614092-63614114 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
1176420381 21:6509331-6509353 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1177507922 21:22041303-22041325 CTTCCTTCTGTGTCTTCCCTCGG + Intergenic
1178323346 21:31623082-31623104 GCCCTATGTGTGTCTTCCCTTGG - Intergenic
1179585769 21:42373279-42373301 GTCTCTTCTGGGTCTCCCCTAGG + Intronic
1179695872 21:43117651-43117673 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1179916231 21:44480072-44480094 GTGTCCTCTGTCTCTTGCCTTGG + Intergenic
1180186673 21:46143409-46143431 GTGCCCTCGGTCTCTTGCCTGGG - Intronic
1180201149 21:46225040-46225062 GTGCCCTCGGTCTCTTGCCTTGG - Intronic
1180992842 22:19948197-19948219 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1181054252 22:20252664-20252686 CTCCCTGCTGTGTCATCCCTGGG - Intronic
1181129427 22:20721660-20721682 GTCTCCTCTGTGTCTTCCCATGG + Intronic
1181273455 22:21674096-21674118 GCTCCCGCTGTGTCTCCCCTGGG + Intronic
1181597988 22:23929934-23929956 GTGCCCTCGGTTTCTTGCCTCGG - Intergenic
1181640029 22:24191430-24191452 GTCACCTCTGTGACTCCCCTTGG - Intergenic
1181729968 22:24837971-24837993 GTGTCCTCTGTCTCTTGCCTCGG + Intronic
1182303040 22:29349435-29349457 GGCCCCTGTCTGGCTTCCCTGGG - Intronic
1183179066 22:36246428-36246450 CTGCCCTGTGTGTCTTCCTTAGG - Intergenic
1183301396 22:37060781-37060803 GTCTCCACTCTTTCTTCCCTGGG + Intronic
1184133613 22:42532791-42532813 GTGCCCTCAGTCTCTTGCCTCGG - Intergenic
1184136372 22:42552475-42552497 GTGCCCTCGGTCTCTTGCCTTGG + Intergenic
1184344497 22:43904881-43904903 GTGTCCTCTGTCTCTTGCCTTGG + Intergenic
1184367049 22:44058364-44058386 TGCCCCTCTGTGTCTTCCTATGG + Intronic
1184991256 22:48171504-48171526 CTCCCCTCCCTGTCTGCCCTGGG + Intergenic
1185328690 22:50241005-50241027 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
1185355703 22:50368632-50368654 GTGCCCTCAGTCTCTTGCCTTGG + Intronic
950150719 3:10685141-10685163 GTCCCCACTGTTTAATCCCTGGG + Intronic
950945764 3:16944590-16944612 CTCCTCTCTGTGTCTTCACATGG - Intronic
951275476 3:20679910-20679932 GTTCTCTCTCTGTCTTCCCCAGG + Intergenic
953171780 3:40513637-40513659 GTGCCCTCAGTCTCTTGCCTTGG - Intronic
954013754 3:47666796-47666818 GTCCAATCTTTGGCTTCCCTGGG - Intronic
954423052 3:50428721-50428743 GCCCCCTCAGTTTCTTCCTTGGG - Intronic
957279895 3:78137094-78137116 TTCTCCTCTGATTCTTCCCTTGG + Intergenic
958441653 3:94162982-94163004 TTCCCTCCTGTGTATTCCCTTGG - Intergenic
958918671 3:100078502-100078524 GTCCAATCTTTGGCTTCCCTGGG + Intronic
960010880 3:112833737-112833759 GCCCTCCCTGTGTGTTCCCTAGG + Intronic
960593472 3:119387498-119387520 GTGTCCTCTGTCTCTTGCCTCGG + Intronic
960694859 3:120386152-120386174 CTCCTCACTGTGTCTTCGCTTGG - Intergenic
961353349 3:126317643-126317665 TTCTCCCCTGAGTCTTCCCTTGG - Intergenic
962002754 3:131316439-131316461 GTACCTTCTGTGTCATGCCTAGG - Intronic
962309134 3:134313295-134313317 GTCCCCTCTCCCTCTTCCCCGGG - Intergenic
963127464 3:141828403-141828425 GTCCTCTCTGTGTCTTCTCATGG + Intergenic
963160901 3:142149711-142149733 GTTCCCCCTGTGGCCTCCCTGGG + Intergenic
963232969 3:142927467-142927489 CTCCTCTCTGTGCCTTCACTTGG + Intergenic
963458802 3:145579433-145579455 TTCTCCTCTGATTCTTCCCTTGG + Intergenic
964101345 3:152991927-152991949 GTGCCCTCAGTCTCTTGCCTCGG - Intergenic
964360373 3:155889366-155889388 GGCCCCTTTATGTCTTACCTTGG + Intronic
964405433 3:156343615-156343637 CTTCCCTCTTTGTCTCCCCTTGG + Intronic
964658549 3:159094968-159094990 GCTCTCTCAGTGTCTTCCCTGGG + Intronic
964766772 3:160186988-160187010 TTCCCCTTTGTCTCTTCTCTGGG - Intergenic
966666675 3:182479514-182479536 GTCTCCTCTTTGTTTGCCCTGGG + Intergenic
966887720 3:184386125-184386147 CTCCCCTCTGGGGCTACCCTTGG - Exonic
968050772 3:195653527-195653549 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
968105048 3:195994820-195994842 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
968229229 3:196995509-196995531 TTCACCTATGTCTCTTCCCTTGG - Intronic
968303348 3:197632411-197632433 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
968350854 3:198050696-198050718 GTGCCCTCAGTCTCTTGCCTCGG - Intergenic
968404783 4:330537-330559 GTGCCCTCAGTTTCTTGCCTCGG + Intergenic
968644139 4:1730496-1730518 GTGCCCTTGGTGTCTTGCCTTGG + Intronic
968846705 4:3046953-3046975 GTGCCCTCGGGGTCTTGCCTTGG - Intergenic
969285458 4:6199805-6199827 GTCCCCTCCGTGTCTTCCGCAGG - Intronic
969428690 4:7140575-7140597 GCCCCAGCTGTGTCTTGCCTTGG + Intergenic
972633345 4:40860529-40860551 GTCCTATGTGTGTCTTCCTTGGG + Intronic
972848539 4:43019741-43019763 TTTCTCTCTGTGTCTTCTCTGGG + Intronic
974691617 4:65304598-65304620 GTCCCTTCTGTGTCTTCACATGG - Intergenic
975134249 4:70858733-70858755 TGCCCCTCTTTGTCTTTCCTTGG - Intergenic
975377874 4:73666399-73666421 GTGCCCTCGGTCTCTTGCCTTGG + Intergenic
975378507 4:73671811-73671833 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
976809009 4:89080348-89080370 GTCCTTTATGTGTCTTCACTGGG + Intronic
977093850 4:92714311-92714333 GCCACCTCTGTGTCTTCACATGG + Intronic
980007554 4:127559269-127559291 CTGCCCTCAGTGTCTCCCCTTGG - Intergenic
981092190 4:140743298-140743320 GTCCCATCATTGTCCTCCCTTGG - Intronic
981525672 4:145705016-145705038 TTCTCCCCTGTTTCTTCCCTTGG + Intronic
983011239 4:162550262-162550284 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
984084497 4:175292192-175292214 GTTCCTTCTGATTCTTCCCTTGG + Intergenic
984163996 4:176286227-176286249 CTCCCCTCTGTGTCCTCCAGAGG - Intergenic
984807919 4:183768384-183768406 GTCCTCTCAGTGTCTGCCCAGGG + Intergenic
985313168 4:188626054-188626076 GTCCCCTCTCTGTCTTGTCTTGG + Intergenic
985613369 5:903533-903555 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
986466671 5:8032966-8032988 CTCATCACTGTGTCTTCCCTTGG + Intergenic
986794341 5:11194161-11194183 GTCCCCTCTGTGTGTATCCTGGG - Intronic
987096807 5:14557472-14557494 TTCTCCTCTGATTCTTCCCTTGG - Intergenic
990345763 5:54869664-54869686 GTATCCTGTGAGTCTTCCCTTGG + Intergenic
991181517 5:63756672-63756694 TCCCTCTCTGTGTCTACCCTGGG + Intergenic
992297715 5:75342654-75342676 GTCCCCACTATGACTTCCCAGGG - Exonic
992347075 5:75890372-75890394 GTCCCCACTCTGCCTTTCCTAGG - Intergenic
992503317 5:77362853-77362875 GCCCCCTCTGTGACTGCCCCCGG + Intronic
992524156 5:77590424-77590446 GTGCCATCTGTGTGGTCCCTTGG - Intronic
996184439 5:120458722-120458744 GTGCCCTCGGTCTCTTACCTTGG + Intergenic
996620559 5:125496855-125496877 GTCTTCTCTGTGTCTTCACGTGG - Intergenic
996906777 5:128610092-128610114 TTCTCCTCTGATTCTTCCCTTGG + Intronic
998074686 5:139225962-139225984 TTCTCCTCTGATTCTTCCCTTGG + Intronic
998411843 5:141917152-141917174 GTCCCAGCTGTCTCTTCCCTTGG + Intergenic
998736237 5:145144541-145144563 GTCTCATCTGTGTCTTTTCTGGG + Intergenic
999830852 5:155318023-155318045 GTCACTGCTGTCTCTTCCCTTGG + Intergenic
1000171443 5:158706686-158706708 TTTCCCACAGTGTCTTCCCTTGG - Intronic
1000210112 5:159100589-159100611 GTCCCCTCTCCGTCCTCGCTCGG - Intergenic
1001081724 5:168672230-168672252 GTCCCTTCTGGGGCTGCCCTCGG + Intronic
1001787155 5:174423719-174423741 GTCTCCTCTGAGCCTTGCCTGGG + Intergenic
1002550903 5:179990973-179990995 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1002649442 5:180680981-180681003 GTGCCCTCGGTCTCTTGCCTCGG + Intergenic
1002835406 6:861330-861352 GAACCCGCTGAGTCTTCCCTGGG - Intergenic
1003182811 6:3806567-3806589 GTCCCCTGTGTGCCTTCCCAGGG - Intergenic
1004291805 6:14374346-14374368 TTCTCCTCTGATTCTTCCCTTGG + Intergenic
1005709675 6:28491071-28491093 GTGTCCTCTGTCTCTTGCCTCGG - Intergenic
1006918642 6:37613332-37613354 GGCCCCTCTCTGACTCCCCTGGG + Intergenic
1007232320 6:40356801-40356823 GTCCCCCATGAGTCTTCCCCAGG - Intergenic
1009640376 6:66327954-66327976 TCCCCCTCAGTGTCTTCCATTGG + Intergenic
1010773257 6:79857126-79857148 TTCTCCTCTGATTCTTCCCTTGG + Intergenic
1010854413 6:80820348-80820370 GTCTCCTCAGTGACTGCCCTAGG + Intergenic
1013629874 6:111976003-111976025 GTCCCCTCTGTCCCTTCTATTGG + Intergenic
1014755356 6:125296804-125296826 GTCCCCTCTGTGCCTGTCCATGG + Intronic
1015440295 6:133240814-133240836 GTCCCTTCTGTCTCCTCCCTTGG + Intronic
1015658400 6:135545928-135545950 CACACATCTGTGTCTTCCCTTGG + Intergenic
1016852633 6:148636557-148636579 CTTCCCCCTGTGTCTTCACTTGG - Intergenic
1018610346 6:165642224-165642246 TTCTCCTCTGTCTCTTCCTTGGG + Intronic
1018761618 6:166898791-166898813 CTCCCCTCTGTGTGTTCACATGG - Intronic
1018761676 6:166899108-166899130 CTCCCCTCTGTGCGTTCACTGGG - Intronic
1018762035 6:166901281-166901303 CTCCCCTCTGTGTGTTCACCCGG - Intronic
1018762172 6:166902187-166902209 CTCCCCTCTGTGCCTTCACCAGG - Intronic
1018762215 6:166902432-166902454 CTCCCCTGTGTGTGTTCCCCTGG - Intronic
1019093746 6:169562556-169562578 GTCACCTCTGTGCCTCCCTTGGG - Intronic
1020258466 7:6516227-6516249 GTGCCCTCGGTCTCTTGCCTTGG - Intronic
1022705705 7:32800359-32800381 GTGCCCTCGGTCTCTTGCCTTGG - Intergenic
1023132387 7:37015638-37015660 GTCCCCTCTGCCTTCTCCCTTGG + Intronic
1024011084 7:45267349-45267371 ATCCCCTGTGTCCCTTCCCTGGG + Intergenic
1024117765 7:46209516-46209538 GTCCTCTCTGTGTCCTCACATGG + Intergenic
1026129777 7:67610638-67610660 CTCCCCTCTGTATCTGCCCCAGG + Intergenic
1026434772 7:70386171-70386193 GCCCTCTATATGTCTTCCCTGGG + Intronic
1026731838 7:72918641-72918663 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1026882836 7:73918449-73918471 CTGCCCTCTCTGTCTACCCTGGG + Intergenic
1028053301 7:86210660-86210682 GACTCCTCTCTGTCTCCCCTGGG - Intergenic
1029113128 7:98223526-98223548 CTCCCCACTGCTTCTTCCCTTGG + Intronic
1029277515 7:99415977-99415999 GTGCCCTCGGTTTCTTGCCTCGG + Intronic
1029283409 7:99450847-99450869 CTGCCCTCCGTATCTTCCCTGGG + Intronic
1029381522 7:100218407-100218429 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
1029400955 7:100345724-100345746 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
1029507065 7:100968973-100968995 GTCACCTCTGTGTCTGGCCAGGG + Intergenic
1029738824 7:102479860-102479882 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1029755949 7:102573516-102573538 GTGCCCTCGGTCTCTTGCCTCGG - Intronic
1029773890 7:102672588-102672610 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1030606570 7:111644485-111644507 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1031313320 7:120227164-120227186 CTTCCCTCTGTGTCTTCCCATGG + Intergenic
1034484554 7:151350725-151350747 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
1034579531 7:152030549-152030571 GTGCCCTCAGTCTCTTGCCTCGG + Intronic
1035046723 7:155972735-155972757 TTCCTCCCTGTCTCTTCCCTGGG - Intergenic
1035324316 7:158055012-158055034 GTGCCCTCAGTCTCTTGCCTCGG - Intronic
1036222719 8:6934234-6934256 AGACCCACTGTGTCTTCCCTGGG + Intergenic
1036500364 8:9308619-9308641 GTTCCCTCTCTGTCTTCTCTTGG - Intergenic
1038044304 8:23753208-23753230 GTCAGCTCTGTGTTTTCTCTGGG - Intergenic
1038165614 8:25082591-25082613 GTCTTCTCTGTGTCTTCACATGG - Intergenic
1039007062 8:33051088-33051110 GTCCCTTCTGTTTCCTTCCTGGG + Intergenic
1039096973 8:33896849-33896871 TTCTCCTCTGATTCTTCCCTTGG - Intergenic
1039704800 8:39995577-39995599 GTGCCCTCTGTCTCTTGCCTTGG - Intronic
1040879750 8:52192052-52192074 GACCCCTCTGTGCCAGCCCTGGG - Intronic
1044063567 8:87669878-87669900 TTCTCCTCTGTGTCTTCACATGG + Intergenic
1044139850 8:88636940-88636962 GCCCCCTGTGTTTCTTCTCTTGG + Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1046212764 8:111100461-111100483 GTGCCCTCGGTCTCTTACCTTGG - Intergenic
1046729483 8:117709764-117709786 GTTCCTTCAGTGTCTCCCCTTGG + Intergenic
1047167680 8:122458407-122458429 GTTTCCACTGTGTCCTCCCTGGG - Intergenic
1047473760 8:125205129-125205151 TACCCCTCTTTCTCTTCCCTTGG + Intronic
1048049527 8:130804317-130804339 GTCTTCCCTGTGTCTTCACTTGG + Intronic
1048290421 8:133177066-133177088 CTCCGCTCTGTGTCTTCACATGG - Intergenic
1048820709 8:138378170-138378192 GTCCTATCTGTGTCTTCCAATGG - Intronic
1048940451 8:139396079-139396101 GTCTTCTCTCTGTCTGCCCTGGG + Intergenic
1048998063 8:139806376-139806398 GTCCCCTCTGTCACTGTCCTTGG + Intronic
1049062927 8:140290160-140290182 GTCCCCTCAGGGCCTTGCCTGGG + Intronic
1049376306 8:142290929-142290951 TGCCCCTCTGTGTCTGCACTGGG - Intronic
1049458809 8:142710730-142710752 GTGCCCTCGGTCTCTTGCCTTGG + Intergenic
1049584781 8:143427851-143427873 GTGCCCTCTGCGTCTGCCCTCGG - Intronic
1049846720 8:144806064-144806086 GTGCCCTCGGTCTCTTGCCTTGG + Intronic
1049847147 8:144808348-144808370 CTGCCCTCTGTGTCCTCCCCGGG - Exonic
1049869379 8:144961727-144961749 GTGCCTTCTGTCTCTTGCCTCGG + Intergenic
1049879974 8:145055150-145055172 GTGCCCTCAGTCTCTTTCCTCGG - Exonic
1050934647 9:11380047-11380069 GGACCCTCTGTGTTTTCCCAAGG + Intergenic
1051598805 9:18851666-18851688 GTCTCTTCTGATTCTTCCCTTGG + Intronic
1055718483 9:79144851-79144873 GGTCTCTCTGTGTCTACCCTTGG + Intergenic
1056094560 9:83239364-83239386 TTCTCCCCTGGGTCTTCCCTTGG - Intergenic
1056506219 9:87260524-87260546 GTCTCTTCTGTCTCTTCTCTGGG - Intergenic
1056860038 9:90172672-90172694 GCCCCATCTGTGTCCTGCCTGGG + Intergenic
1056883601 9:90418985-90419007 GAACCCTCTGTGTCATCTCTCGG - Intergenic
1057554406 9:96076162-96076184 GTGCCCTCGGTCTCTTGCCTTGG - Intergenic
1058870573 9:109198301-109198323 GTCCCCTTTCTTTCTTCTCTAGG - Intronic
1059543327 9:115152130-115152152 TTGCCCTATGTGTTTTCCCTGGG - Intronic
1060926055 9:127456056-127456078 CTCCCCTCTGAATCTCCCCTGGG - Intronic
1061039276 9:128130429-128130451 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1061048692 9:128181360-128181382 GTGTCCTCTGTCTCTTGCCTCGG - Intronic
1061785467 9:133025201-133025223 GTGCCCTCGGTCTCTTGCCTTGG - Intergenic
1061835935 9:133329786-133329808 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1062107480 9:134763882-134763904 CTCCTCTCTTTGGCTTCCCTGGG - Intronic
1062159606 9:135073057-135073079 GTCCCTGCTTTCTCTTCCCTTGG + Intergenic
1062256437 9:135624670-135624692 TTCCCCACTGTGTGTTTCCTAGG - Exonic
1062557540 9:137121401-137121423 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic
1062642379 9:137526147-137526169 GTGCCCTCGGTCTCTTGCCTCGG + Intronic
1185805207 X:3050699-3050721 TTCTCCGCTGAGTCTTCCCTTGG + Intronic
1186570738 X:10712520-10712542 TTCTCCTCTGATTCTTCCCTTGG - Intronic
1189492450 X:41480723-41480745 TTCTCCCCTGAGTCTTCCCTTGG - Intergenic
1190434424 X:50409185-50409207 GTTCCCTCTGTATCTTCACATGG - Intronic
1194009634 X:88545118-88545140 GTTCCCTCTGTGTCTTCTTATGG - Intergenic
1194169174 X:90560781-90560803 TTCCCCTCTGTGTTTTCAATTGG + Intergenic
1195511202 X:105717269-105717291 GTCACCTCTGAGTTTTCCTTTGG + Intronic
1195727072 X:107929247-107929269 GTCACCTTTGTCTCTTCCCTAGG + Intergenic
1196736207 X:118982984-118983006 CTCCCCTCTCTGTCTTATCTAGG + Intronic
1197078000 X:122376042-122376064 GTGTCCTCTGTCTCTTGCCTCGG + Intergenic
1197318463 X:124997752-124997774 GTCTCCTCTGTGTCTCCTTTTGG - Intergenic
1197825347 X:130584268-130584290 GTCTCCTCTGTGTCATCACGTGG + Intergenic
1198272281 X:135066100-135066122 GTGCCCTCGGTCTCTTGCCTTGG - Intergenic
1199453247 X:147997119-147997141 GTCCCTGCTCTTTCTTCCCTGGG - Intronic
1200515417 Y:4138566-4138588 TTCCCCTCTGTGTTTTCAATTGG + Intergenic
1200775543 Y:7167133-7167155 TTCGCCCCTGAGTCTTCCCTTGG + Intergenic
1201543747 Y:15137954-15137976 GTGCCCTCGGTCTCTTGCCTCGG - Intergenic