ID: 1103926604

View in Genome Browser
Species Human (GRCh38)
Location 12:124426865-124426887
Sequence GTCCCCTCTGTGTCTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 454}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103926604_1103926611 17 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926611 12:124426905-124426927 GCAGGGAAAACGCGAAACCAAGG 0: 1
1: 0
2: 0
3: 5
4: 113
1103926604_1103926612 23 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926612 12:124426911-124426933 AAAACGCGAAACCAAGGAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1103926604_1103926608 -1 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926608 12:124426887-124426909 CGGATGGTCTGCGCCAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 87
1103926604_1103926609 0 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926609 12:124426888-124426910 GGATGGTCTGCGCCAGAGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103926604 Original CRISPR GTCCCCTCTGTGTCTTCCCT GGG (reversed) Intronic