ID: 1103926608

View in Genome Browser
Species Human (GRCh38)
Location 12:124426887-124426909
Sequence CGGATGGTCTGCGCCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103926604_1103926608 -1 Left 1103926604 12:124426865-124426887 CCCAGGGAAGACACAGAGGGGAC 0: 1
1: 0
2: 5
3: 32
4: 454
Right 1103926608 12:124426887-124426909 CGGATGGTCTGCGCCAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 87
1103926605_1103926608 -2 Left 1103926605 12:124426866-124426888 CCAGGGAAGACACAGAGGGGACG 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1103926608 12:124426887-124426909 CGGATGGTCTGCGCCAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 87
1103926597_1103926608 16 Left 1103926597 12:124426848-124426870 CCGGCCGGCGCAGGGGACCCAGG 0: 1
1: 0
2: 1
3: 16
4: 252
Right 1103926608 12:124426887-124426909 CGGATGGTCTGCGCCAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 87
1103926600_1103926608 12 Left 1103926600 12:124426852-124426874 CCGGCGCAGGGGACCCAGGGAAG 0: 1
1: 0
2: 1
3: 41
4: 323
Right 1103926608 12:124426887-124426909 CGGATGGTCTGCGCCAGAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103926608 Original CRISPR CGGATGGTCTGCGCCAGAGC AGG Intronic