ID: 1103929587

View in Genome Browser
Species Human (GRCh38)
Location 12:124442672-124442694
Sequence GGTACACTGCCTAGTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103929579_1103929587 20 Left 1103929579 12:124442629-124442651 CCGTGGTGAAGACCATACAAAAT 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1103929587 12:124442672-124442694 GGTACACTGCCTAGTACAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 86
1103929583_1103929587 8 Left 1103929583 12:124442641-124442663 CCATACAAAATTGACTTTGGGGT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1103929587 12:124442672-124442694 GGTACACTGCCTAGTACAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103929587 Original CRISPR GGTACACTGCCTAGTACAGG TGG Intronic
904068992 1:27778240-27778262 GGTTGACTGCCTGGTACAAGTGG + Intronic
904344826 1:29860943-29860965 GGCACACTACCTACTGCAGGAGG + Intergenic
912621907 1:111169195-111169217 GATACACTTCTTAGTACAGTCGG - Intronic
1072640198 10:97205847-97205869 AGTTCACAGTCTAGTACAGGAGG + Intronic
1074202425 10:111249906-111249928 GCTGCACTGCCTAGAACTGGGGG - Intergenic
1076496309 10:130899923-130899945 GGTGCACTCCCTAGCACAGACGG + Intergenic
1080464351 11:32482820-32482842 AGAACCCTGACTAGTACAGGTGG - Intergenic
1095664234 12:44776793-44776815 TATACACTGCTTACTACAGGAGG - Intronic
1098023156 12:66175181-66175203 GGTACACTTCCCAGACCAGGCGG - Intergenic
1101398471 12:104368264-104368286 GGAACCCTGCCTAATACAGTGGG + Intergenic
1101739842 12:107492356-107492378 GGAACAGTGCCTAGCACAGAGGG - Intronic
1103929587 12:124442672-124442694 GGTACACTGCCTAGTACAGGTGG + Intronic
1104043909 12:125148149-125148171 GGAACCCTGACTAATACAGGGGG + Intergenic
1104769814 12:131354415-131354437 GGGACAGAGCCTGGTACAGGGGG - Intergenic
1109645774 13:65252992-65253014 GGTACTCTGCTTAGTACCTGGGG - Intergenic
1110445788 13:75578465-75578487 AGCACAGTGCCTAGTACAGTAGG - Intronic
1114688240 14:24555372-24555394 GGTGCACTGCCTAGTGGAGCTGG + Intergenic
1115289224 14:31751721-31751743 GGGACACTGCCTAGTGGAGCTGG - Intronic
1122634703 14:103124509-103124531 GGGACAGAGCCTAGTACATGTGG + Intronic
1137590440 16:49690101-49690123 GGCACACTGCCTTGTACACTGGG - Intronic
1140674881 16:77318268-77318290 GGTACAAAGCCTACTAGAGGTGG - Intronic
1140756341 16:78070972-78070994 GATAAACTGCCTTGTATAGGGGG + Intergenic
1151394978 17:73817066-73817088 AGAACACGGCCTAGTACAGATGG + Intergenic
1151921570 17:77160313-77160335 CGTACTCTGCCAAGTCCAGGCGG + Intronic
1154082655 18:11273613-11273635 GGGACTCTGCCAAGTAAAGGAGG + Intergenic
1159493280 18:69166490-69166512 TGTACACTGACTGATACAGGTGG + Intergenic
1168313862 19:55475358-55475380 GGGACACCACCTAGCACAGGAGG + Intergenic
1168513508 19:56992293-56992315 GGGACCCAGCCTACTACAGGAGG + Intergenic
933174071 2:79157217-79157239 AGTTCACTGACTAGTGCAGGAGG - Exonic
935200914 2:100855870-100855892 TGCACAATGCCTAGTACAGAGGG + Intronic
938139981 2:128787389-128787411 GGTGCACTGGCTGGCACAGGAGG - Intergenic
940645080 2:156383171-156383193 GTTAAACTGCCTGATACAGGAGG - Intergenic
941967310 2:171312735-171312757 GGGACACTGCCTAGTGGAGCTGG + Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947355737 2:229293379-229293401 GCTATACTGCCCAGTACAGTAGG - Intergenic
948735508 2:240001923-240001945 GTTACAGTGCCTACTCCAGGTGG - Intronic
1169752549 20:9009328-9009350 GGTAGCATGCCTAGTAAAGGAGG + Intergenic
1179962289 21:44775015-44775037 GGTACAGTGCAAAGGACAGGTGG - Intronic
1180728667 22:17964841-17964863 GGGACACTGGCTGGTTCAGGAGG + Intronic
1184491203 22:44810161-44810183 GGATCACAGCCTAGTGCAGGAGG - Intronic
950749281 3:15116078-15116100 GGGCCAGTGCCTAGCACAGGAGG - Intergenic
954389056 3:50259511-50259533 TGTATGCTGCCTAGTCCAGGTGG - Intergenic
955181220 3:56672005-56672027 GGTACACTGCATCCAACAGGTGG + Intronic
964424277 3:156534755-156534777 GTTACACTGCCTGGGATAGGTGG - Intronic
968706418 4:2080436-2080458 GGCACACTGCCTGGCACTGGTGG + Intronic
968706435 4:2080496-2080518 GGCACACTGCCTGGCACTGGTGG + Intronic
968892835 4:3380423-3380445 GGGACACTGCCTAGTGGAGCTGG - Intronic
970977411 4:22057402-22057424 GGGGCACTGCCTAGTAGAGCTGG + Intergenic
971701537 4:29984137-29984159 GCTACACTGCCTAGTGCTGGGGG - Intergenic
978352618 4:107836214-107836236 GCTGCAGTGCCCAGTACAGGAGG - Intronic
981570005 4:146141958-146141980 GGGACCCTGACTAATACAGGTGG - Intergenic
983412503 4:167418320-167418342 GCTCCTCTGCCTAGTAAAGGAGG - Intergenic
983892643 4:173046471-173046493 GGTGAACTGCCTAGTTCTGGGGG - Intergenic
984896261 4:184543247-184543269 GCTTCACTGCCTAATCCAGGGGG - Intergenic
985961575 5:3306806-3306828 GGGACACTGGCTGTTACAGGAGG + Intergenic
986582372 5:9278983-9279005 GGAACACTGCCTAGTGGAGCTGG + Intronic
986849534 5:11795127-11795149 AGTACACTGTCTAACACAGGAGG - Intronic
987109543 5:14672420-14672442 GGTATATGGCCTAGTACAGCTGG - Intronic
992747727 5:79835699-79835721 TGTATAGTGCCTAGTACAGAAGG - Intergenic
995885338 5:116888210-116888232 GGTTCCTTGCCTAGTACAGTTGG - Intergenic
998034416 5:138902012-138902034 AGCACACTGCCTATTTCAGGAGG - Intronic
999605104 5:153305891-153305913 GGCACACTGCCTCCTCCAGGTGG - Intergenic
1000970775 5:167711748-167711770 GGCACACTGCAAAGAACAGGTGG - Intronic
1002163876 5:177332798-177332820 GGTACGCTCCCTTGTACAGGCGG + Intronic
1008594953 6:53032904-53032926 GGTACATTGCCTGGTGCTGGGGG - Intronic
1009325635 6:62345375-62345397 GGTACAATGCCAGATACAGGTGG - Intergenic
1009942062 6:70301735-70301757 AGTGCAGTGCCTAGTACAGATGG - Intronic
1013489222 6:110629078-110629100 GGTATACTGCATAGTAGAGGTGG - Intronic
1014734312 6:125074196-125074218 GGAACACAGCATATTACAGGCGG - Intronic
1015708618 6:136115049-136115071 GGTACAATGCCTACCATAGGAGG - Intronic
1026134449 7:67647095-67647117 AGAACCCTGGCTAGTACAGGTGG - Intergenic
1028763627 7:94524496-94524518 GGTACACAGCCTAATACATCTGG - Intronic
1028834292 7:95357368-95357390 GGTAAATTGCCTACTCCAGGAGG + Intergenic
1031588731 7:123564450-123564472 GGAACCCTGACTAATACAGGAGG - Intergenic
1032357106 7:131221335-131221357 GGTGCCCTGCCTAGTGCTGGAGG + Intronic
1033725454 7:144111378-144111400 GGTACTATGCCTAGTACCTGGGG - Intergenic
1035627662 8:1084488-1084510 GGTACAAAGCCTCGGACAGGAGG - Intergenic
1038044535 8:23754876-23754898 GGAACCCTGCCTCGTACAGGTGG + Intergenic
1041979798 8:63844551-63844573 AGAACCCTGCCTAATACAGGAGG + Intergenic
1042108857 8:65357471-65357493 AGTACTCTTCCTAGTACAGAGGG - Intergenic
1043951984 8:86319607-86319629 AGTACACTGTCTATAACAGGTGG + Intronic
1056197899 9:84246132-84246154 GGTACAGTGCCTAACACTGGGGG + Intergenic
1057975787 9:99604723-99604745 GGTACATTGAGTTGTACAGGGGG + Intergenic
1062426317 9:136507784-136507806 GGTAGACTGCCTGGAAGAGGTGG - Intronic
1186840374 X:13478959-13478981 GGTATGCTGCCTGGTACAGCTGG + Intergenic
1189290371 X:39880896-39880918 TGTCCACTGCCCACTACAGGGGG + Intergenic
1194176947 X:90662155-90662177 GGTACACTGGCTACTATAGCAGG - Intergenic
1197339430 X:125247892-125247914 GGCACTGTGCCTAGTACAAGTGG - Intergenic
1197597874 X:128488923-128488945 GGAACCCTGCCTAGTCCAAGTGG + Intergenic
1198387653 X:136144908-136144930 GCTACACTGCCTAGGAGAAGAGG - Intergenic
1198792753 X:140363382-140363404 TGTAAACTGCCTATTGCAGGTGG + Intergenic