ID: 1103930555

View in Genome Browser
Species Human (GRCh38)
Location 12:124448538-124448560
Sequence TTCACCAGCGTGGCTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103930555_1103930563 17 Left 1103930555 12:124448538-124448560 CCCCCGCCAGCCACGCTGGTGAA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1103930563 12:124448578-124448600 TCCTGAACCCGAGAAGGCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 218
1103930555_1103930565 18 Left 1103930555 12:124448538-124448560 CCCCCGCCAGCCACGCTGGTGAA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1103930565 12:124448579-124448601 CCTGAACCCGAGAAGGCCAAGGG 0: 1
1: 0
2: 1
3: 3
4: 124
1103930555_1103930562 11 Left 1103930555 12:124448538-124448560 CCCCCGCCAGCCACGCTGGTGAA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1103930562 12:124448572-124448594 AGGTGCTCCTGAACCCGAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 114
1103930555_1103930561 -9 Left 1103930555 12:124448538-124448560 CCCCCGCCAGCCACGCTGGTGAA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1103930561 12:124448552-124448574 GCTGGTGAAGTATCTTTGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103930555 Original CRISPR TTCACCAGCGTGGCTGGCGG GGG (reversed) Intronic
902685384 1:18073386-18073408 TTCACCAGGAAGGCTGGGGGAGG - Intergenic
906410407 1:45574167-45574189 TTAACTAGCGGGGCTGGGGGAGG + Intergenic
915212950 1:154323769-154323791 TTCACCTACGTGGCTGGCTGGGG + Exonic
1063002180 10:1934839-1934861 TTACCCAGCGTGCCAGGCGGAGG + Intergenic
1070911550 10:80123289-80123311 TGCAGCAGCGTGGATGGAGGTGG + Intergenic
1071394295 10:85206356-85206378 GGGACCAGCGTGGCTGGAGGAGG + Intergenic
1072567892 10:96633028-96633050 TTCACCAGCGTGGCCTGCTATGG - Intronic
1075054133 10:119205865-119205887 GTGACCAGCGTGGTTGGTGGAGG + Intergenic
1078507069 11:11960213-11960235 TGCACCAGCTTGACTGGTGGTGG + Intergenic
1078681439 11:13480353-13480375 GTCAGCAGCGAGGCTGGGGGAGG + Intergenic
1082103182 11:48191453-48191475 GTCAGCAGCGAGGCTGGGGGAGG - Intergenic
1084741933 11:71145773-71145795 TTCCCCATCGTGGCTGGGGCCGG + Intronic
1085361031 11:75887426-75887448 TGAACCAGCGTGCCTGGCGCAGG + Intronic
1085391548 11:76184785-76184807 TTCAACAGAGGGGCTGGCAGGGG + Intergenic
1087088983 11:94248468-94248490 GGCAGCAGCGTGGCTGGGGGAGG + Intergenic
1097274528 12:57803467-57803489 TTCACAAGCCTGGCAGGCAGGGG + Intronic
1097310612 12:58114872-58114894 GGCAGCAGCGAGGCTGGCGGAGG - Intergenic
1098322402 12:69258946-69258968 TTCACATGCGGAGCTGGCGGTGG - Exonic
1099428274 12:82550926-82550948 TTTGGCAGCGTGGCTGGGGGAGG - Intergenic
1100260459 12:92928664-92928686 TTCTCCAGCCCGGCAGGCGGCGG + Intronic
1103786474 12:123436617-123436639 CTCTCCAGCGTGGCTGGCAGCGG - Exonic
1103930555 12:124448538-124448560 TTCACCAGCGTGGCTGGCGGGGG - Intronic
1105957982 13:25301813-25301835 TCCACCACCGTGGCCGCCGGCGG + Exonic
1112507967 13:99986377-99986399 TTCACAAGCGTTGTTGGTGGTGG - Exonic
1113739843 13:112703981-112704003 TTCACCTGCGTGTGTGGAGGAGG + Intronic
1113853192 13:113429469-113429491 TTCACCCGCGTGGCTCGCCACGG + Intronic
1114073438 14:19132883-19132905 TTCCCCATGGTCGCTGGCGGTGG + Intergenic
1114088827 14:19267100-19267122 TTCCCCATGGTCGCTGGCGGTGG - Intergenic
1119485684 14:74985052-74985074 GGCACCAGCGTGGCTCCCGGGGG + Intergenic
1121580210 14:95024484-95024506 TCAACCAGTGTGGCTGGCGGAGG - Intergenic
1121727377 14:96162645-96162667 TTCACCAGAGTGGGTAGCCGGGG - Intergenic
1124049128 15:26178802-26178824 TTCCCCAGCCTGGCTTTCGGAGG + Intergenic
1132382101 15:101373186-101373208 AGCAGCAGCGGGGCTGGCGGAGG - Intronic
1134024602 16:10944467-10944489 TTCACCCGCGTGGCCTTCGGCGG - Exonic
1138079694 16:54077995-54078017 GTCACCAGCATGGATGGGGGTGG - Intronic
1138577137 16:57915251-57915273 TTAAACAGCGGGGCAGGCGGAGG + Exonic
1141659869 16:85435985-85436007 CTCACCAGTGTGGTTGGCGTGGG + Intergenic
1142810847 17:2394935-2394957 GTCCCCAGCGTGGGTGGGGGCGG + Exonic
1143060813 17:4199223-4199245 TGCACCAGCCTGGGTGGCGGGGG - Intronic
1148081044 17:44967852-44967874 TGCACCAGCGTGGAAGGCGGGGG + Exonic
1151009490 17:70477122-70477144 TTGATTAGCGTGGCTGGTGGGGG + Intergenic
1151945353 17:77316590-77316612 TGACCCAGCCTGGCTGGCGGTGG - Intronic
1151946373 17:77322060-77322082 TCCACCCGCCTGGCTGGCAGGGG + Intronic
1152416592 17:80166721-80166743 CTCTGCAGCGTGGCTGGCTGTGG - Intergenic
1158679373 18:59553066-59553088 ATAACCAGCGTGGCTAGTGGTGG - Intronic
1160979591 19:1810927-1810949 GCGACCAGGGTGGCTGGCGGGGG - Intronic
1161671467 19:5613712-5613734 TCCACCAGCGTCTCTGGCAGTGG + Intronic
1163881148 19:19923625-19923647 GGCACCAGCGAGGCTGGGGGAGG - Intronic
1167798020 19:51723247-51723269 TTCACCTGTGTGGCCGTCGGTGG - Intronic
925393915 2:3518984-3519006 CTCAGCAGCGGGGCTGGTGGGGG - Intronic
926224469 2:10957206-10957228 TGCAGCAGTGTGGCTGGAGGGGG + Intergenic
926712426 2:15891904-15891926 TTCTCTAGCGAGGGTGGCGGGGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
937118073 2:119423367-119423389 TTCATCAGTGTGGTTGGCTGAGG + Intergenic
937147029 2:119656278-119656300 TTCACCAGCACTGCTGGCGGGGG + Intronic
937299349 2:120829729-120829751 TCCACCAGGGTGGCTGCAGGAGG + Intronic
947865688 2:233396913-233396935 GGGACCAGCGTGGCTGGGGGGGG + Intronic
948639132 2:239362595-239362617 GTCACCAGCATGGCAGGCTGAGG - Intronic
948766401 2:240223757-240223779 CGCACCAGAGGGGCTGGCGGAGG - Intergenic
948808858 2:240464949-240464971 TTCTCCAGCGTGCCTGAAGGTGG - Exonic
1171944733 20:31366589-31366611 TTGACAAGAGTGGCTGGCTGTGG + Intergenic
1172125070 20:32620994-32621016 TTCACCAGGGTGGCTGGGGTGGG + Intergenic
1174494666 20:50931108-50931130 TTCACCGGCGCGGGCGGCGGCGG + Exonic
1180491881 22:15855236-15855258 TTCCCCATGGTCGCTGGCGGTGG + Intergenic
1180956757 22:19744725-19744747 TGCACAAGGGTGGCTGGCAGAGG + Intergenic
1183055337 22:35301668-35301690 ATCGCCACCGTGGCTGTCGGTGG + Intronic
1183253156 22:36744341-36744363 TTGACCAGCTTGGCTGGCCAGGG + Intergenic
954735898 3:52706235-52706257 TGCTCCAGCATGGCTGGCTGAGG - Exonic
955099388 3:55832033-55832055 GTCAGCAGCGAGGCTGGGGGAGG + Intronic
956162886 3:66373302-66373324 TTCACCTGCGAGACTGGCTGGGG + Intronic
956195604 3:66651093-66651115 TGGACCAGCGGGGATGGCGGGGG + Intergenic
957811585 3:85229152-85229174 TTCACGAGCTTGGTTGGGGGAGG - Intronic
958011097 3:87881358-87881380 GGCAGCAGCCTGGCTGGCGGAGG + Intergenic
958553557 3:95645451-95645473 AGCAGCAGCGTGGCTGGGGGAGG + Intergenic
961921271 3:130428795-130428817 TTCACAAGGGTGGATGGCAGAGG + Intronic
965701221 3:171460570-171460592 TGCACCAGCGTGGAGGGGGGAGG + Intergenic
974143582 4:57919233-57919255 GGCAGCAGCGAGGCTGGCGGAGG - Intergenic
976687790 4:87835258-87835280 TTCATCAGCGAGGCTAGAGGTGG + Intronic
982171878 4:152670214-152670236 TTCTCCAGGAAGGCTGGCGGGGG + Intronic
982259518 4:153482125-153482147 TACACCACCGTGCCTGGCAGAGG + Intronic
985567547 5:627905-627927 GTCAGCAGCGTGAATGGCGGGGG - Intronic
985611381 5:891539-891561 TGCGCCTGCGTGGCTGGAGGAGG - Intronic
986892134 5:12321503-12321525 TTCAACTGCATGGCTGGAGGGGG + Intergenic
987210400 5:15676166-15676188 TTCACCAACTTGGCTGGGGGTGG + Intronic
988221974 5:28357869-28357891 TTCAACAGTGTGGCTGACTGAGG + Intergenic
995270732 5:110217217-110217239 GTCAGCAGCGAGGCTGGGGGAGG - Intergenic
996746890 5:126853654-126853676 TTCACTCTGGTGGCTGGCGGGGG - Intergenic
1001287015 5:170431185-170431207 TTTACAAGCTAGGCTGGCGGAGG + Intronic
1003134335 6:3422384-3422406 TTCATCAGCCTGGCTTGTGGAGG - Intronic
1003516732 6:6824506-6824528 ATCTCCAGGGTGGCTGGCGATGG - Intergenic
1003649782 6:7948883-7948905 GGCAGCAGCGAGGCTGGCGGAGG - Intronic
1012300867 6:97586370-97586392 TTCTCCAGCTTTGCTGGAGGGGG - Intergenic
1013156063 6:107491358-107491380 TCCTCCAGCGGGGCTGGCCGGGG - Intronic
1017907382 6:158766337-158766359 ATCACCAGCGTGAGTGGTGGAGG - Exonic
1018421133 6:163641910-163641932 CTCACCAGCATGCCTGGCTGTGG - Intergenic
1019348752 7:543331-543353 CTCCCCAGCGTGGCAGCCGGGGG + Intergenic
1019615500 7:1957751-1957773 TTCCCCAGCATGGCTGGCCTCGG - Intronic
1022102044 7:27174543-27174565 TGCCCCAACGTGGCTGGTGGGGG + Intronic
1032455545 7:132070687-132070709 TACAGCAGCCTGGGTGGCGGAGG - Intergenic
1034693185 7:153030389-153030411 TTCACCATGTTGGCTGGCTGGGG + Intergenic
1037928641 8:22864846-22864868 TTCACCAGCCTGGCGCTCGGCGG - Intronic
1040940072 8:52823676-52823698 TTCACCAGCGTGCATGGCTTTGG - Intergenic
1042695202 8:71547793-71547815 CTCCCCACCGTGGCTCGCGGCGG - Intronic
1046998953 8:120554485-120554507 TTGACCTGCGTGGTGGGCGGGGG + Intronic
1052985722 9:34485926-34485948 TTCTCCAGTGGGGCTGGGGGTGG - Intronic
1059963330 9:119589127-119589149 CTCAGCAGCAAGGCTGGCGGGGG - Intergenic
1061327167 9:129870701-129870723 TGGTCCAGCGTGGCTGGCAGTGG - Intronic
1062542055 9:137045873-137045895 CTCACCCGGGTGGCCGGCGGCGG + Exonic
1191125861 X:56953383-56953405 GGCAGCAGCGAGGCTGGCGGAGG - Intergenic
1192654746 X:72981113-72981135 GGCACCAGCCTGGCTGGCAGAGG + Intergenic
1193452148 X:81684359-81684381 TGCAGCAGCGAGGCTGGGGGAGG + Intergenic
1197676658 X:129337458-129337480 GGCAGCAGCGTGGCTGGGGGAGG + Intergenic
1198489308 X:137122837-137122859 GGCACCAGCGAGGCTGGGGGAGG + Intergenic
1201148555 Y:11081445-11081467 TTCAACAGGGAGGCTGGAGGAGG + Intergenic