ID: 1103930879

View in Genome Browser
Species Human (GRCh38)
Location 12:124450155-124450177
Sequence GGGTTTGTCCGGGTGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103930879_1103930889 16 Left 1103930879 12:124450155-124450177 CCAGAGCACACCCGGACAAACCC 0: 1
1: 0
2: 0
3: 1
4: 97
Right 1103930889 12:124450194-124450216 TTGGCCCTGGCCACCAAACGTGG 0: 1
1: 0
2: 1
3: 8
4: 81
1103930879_1103930883 -3 Left 1103930879 12:124450155-124450177 CCAGAGCACACCCGGACAAACCC 0: 1
1: 0
2: 0
3: 1
4: 97
Right 1103930883 12:124450175-124450197 CCCACACACACCCCAGAGATTGG 0: 1
1: 0
2: 7
3: 34
4: 338
1103930879_1103930885 3 Left 1103930879 12:124450155-124450177 CCAGAGCACACCCGGACAAACCC 0: 1
1: 0
2: 0
3: 1
4: 97
Right 1103930885 12:124450181-124450203 CACACCCCAGAGATTGGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 190
1103930879_1103930893 28 Left 1103930879 12:124450155-124450177 CCAGAGCACACCCGGACAAACCC 0: 1
1: 0
2: 0
3: 1
4: 97
Right 1103930893 12:124450206-124450228 ACCAAACGTGGAAAGCCACTTGG 0: 1
1: 0
2: 0
3: 13
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103930879 Original CRISPR GGGTTTGTCCGGGTGTGCTC TGG (reversed) Intronic
900137380 1:1123625-1123647 GTGTGTGTGCAGGTGTGCTCAGG - Intergenic
900177398 1:1297016-1297038 GGGTGTGTGCTGGTGTGCACTGG - Intronic
900178246 1:1300092-1300114 GGGCTGGACCGGGTGTGCTTGGG - Intronic
900807839 1:4779490-4779512 GCGTCTGTCTGGCTGTGCTCCGG - Intronic
905853851 1:41294200-41294222 GGGTTTGTCCTGGAGTTCTCTGG + Intergenic
920510822 1:206550872-206550894 GGATTTGTGCCTGTGTGCTCAGG - Intronic
1063271663 10:4515848-4515870 GGATTTTGCAGGGTGTGCTCAGG - Intergenic
1063892110 10:10641313-10641335 TACTTTGTCCGGCTGTGCTCAGG + Intergenic
1072623582 10:97096714-97096736 GGGTTTTTCTGGGTTTGCTGGGG - Intronic
1077026721 11:442942-442964 GGGCTTGCCGGGGGGTGCTCTGG - Intergenic
1077135572 11:996537-996559 AGGTTTGTCCGGCTAGGCTCAGG + Intronic
1077590629 11:3488245-3488267 GGGGTTGCCCTGGGGTGCTCTGG + Intergenic
1077609233 11:3634219-3634241 GAGTGTGTCTGGGTGAGCTCAGG + Intergenic
1079108217 11:17587873-17587895 GGATTTGCCCAGGGGTGCTCAGG + Intronic
1080040113 11:27751059-27751081 GGTTTTGTCTGTATGTGCTCAGG - Intergenic
1084592395 11:70098254-70098276 GGATTTGTCCAGGTGTTCTGTGG + Intronic
1084826332 11:71734474-71734496 GGGGTTGCCCTGGGGTGCTCTGG - Intergenic
1087248251 11:95866308-95866330 GGGTGTGTCTGTGTGTTCTCTGG - Intronic
1088432524 11:109774466-109774488 GGGTTTGACTGGATGTGGTCTGG - Intergenic
1092416915 12:8297149-8297171 GGGGTTGTCCTGAGGTGCTCTGG + Intergenic
1096355023 12:50933745-50933767 TGGTTCATCTGGGTGTGCTCAGG - Intergenic
1096668151 12:53180762-53180784 GGGGTTGGCAGGGTGTGCTGGGG + Exonic
1097342533 12:58455131-58455153 TGGTTTGTTCTGGTGTGCTTTGG - Intergenic
1103930879 12:124450155-124450177 GGGTTTGTCCGGGTGTGCTCTGG - Intronic
1105724564 13:23148644-23148666 GGGTTTCTCCGTGTTTGATCAGG - Intergenic
1113806573 13:113113627-113113649 GGGTCTGGCGGGGTGGGCTCAGG - Intronic
1117658802 14:57983416-57983438 GGGTTTATCTGGGCATGCTCAGG + Intergenic
1121870402 14:97401828-97401850 GGGTGAGGCAGGGTGTGCTCCGG + Intergenic
1125310609 15:38374649-38374671 GGGTGTGTCCGGGAGGACTCTGG - Intergenic
1127039476 15:54958368-54958390 GGGTTTCTCCAGGTGTTGTCAGG + Intergenic
1129228529 15:74183734-74183756 GAGTTTGTCTGGGAATGCTCTGG - Intronic
1132034084 15:98465661-98465683 GGGTTGGTCTAGGTTTGCTCTGG - Intronic
1133356000 16:5137329-5137351 GGGGTTGCCCTGGGGTGCTCTGG + Intergenic
1135552863 16:23411708-23411730 GGGTGGGTCTGGGTCTGCTCTGG + Intronic
1141983431 16:87564012-87564034 GGGTGTGTGCGTGTGTGCACGGG + Intergenic
1142470062 17:158259-158281 GGGTTTGTCTGGGGGGGCTGAGG - Intronic
1144755289 17:17676497-17676519 GTGTGTGTCGGGGTGTGCTGAGG + Intergenic
1152111535 17:78359929-78359951 CGGTTGGTCCGGGGGTGCGCAGG - Exonic
1152733446 17:81984936-81984958 GGGTGTGTGCGGGTGTGTGCGGG - Intronic
1203167297 17_GL000205v2_random:109323-109345 GGGTCTGTCCCGGTCTTCTCGGG + Intergenic
1158784997 18:60700629-60700651 GGGTTTGTCCAGAAGTCCTCTGG + Intergenic
1160038442 18:75322082-75322104 GGGTTTTTCCGGCTGCCCTCAGG - Intergenic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
927979977 2:27369012-27369034 GGGTTTCTCCAGCTGTGCTGGGG + Exonic
929900347 2:45995651-45995673 GTATTTGTGCGGGTCTGCTCTGG + Intronic
932256775 2:70294448-70294470 GGGATTGGCCGGGTTTGCCCAGG - Intergenic
934921921 2:98351039-98351061 GGGTGTATCCTGTTGTGCTCAGG - Intronic
942307651 2:174624732-174624754 GGGGTTCTGGGGGTGTGCTCAGG + Intronic
943025194 2:182619318-182619340 GCGTTTTTCTGGGTGTTCTCAGG - Intergenic
1174500165 20:50978527-50978549 GGGTTTGGCAAGGTGGGCTCAGG - Intergenic
1175214324 20:57383224-57383246 GGGTTTTACCGTGTGTGCCCAGG + Intergenic
1176404461 21:6349776-6349798 GGGTCTGTCCCGGTCTTCTCGGG - Intergenic
1176432696 21:6639328-6639350 GGGTCTGTCCCGGTCTTCTCGGG + Intergenic
1179022905 21:37656249-37656271 GGGTTCTTCCTGCTGTGCTCAGG + Intronic
1179569089 21:42267533-42267555 GGTTCTGTCTGGGTCTGCTCTGG + Intronic
1179569094 21:42267555-42267577 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179569103 21:42267599-42267621 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179569108 21:42267621-42267643 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179569144 21:42267797-42267819 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179569161 21:42267874-42267896 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179569166 21:42267896-42267918 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179569171 21:42267918-42267940 GGTTCTGTCTGGGTGTGGTCTGG + Intronic
1179654170 21:42834882-42834904 GGGTGTGTCCTGGAGTGCACAGG - Intergenic
1181168290 22:20994753-20994775 GGGTTGGGTGGGGTGTGCTCAGG + Intronic
1181854123 22:25770020-25770042 GGGTTTCTCACAGTGTGCTCTGG - Intronic
1183368469 22:37419365-37419387 GATTCTGTCTGGGTGTGCTCTGG - Intronic
1184890367 22:47375442-47375464 GGCTTTGTCCAGGTGTGTTTGGG - Intergenic
950524042 3:13513244-13513266 GAGTTTCTCAGGGTGTGCCCTGG + Intergenic
956883622 3:73536401-73536423 TGGGTTGTCAGGGTGGGCTCTGG - Intronic
959681398 3:109100589-109100611 GGGTTTGTCCTGATGTTCTGAGG - Intronic
961470611 3:127109054-127109076 TGGTTTGTCCTGGTCTGGTCTGG + Intergenic
961894463 3:130155751-130155773 GGGGTTGTCCTGGGTTGCTCTGG + Intergenic
966750573 3:183317757-183317779 AGCTTTGTCCGGGTGAGCTGAGG - Intronic
969748310 4:9091318-9091340 GGGGTTGCCCTGGGGTGCTCTGG - Intergenic
985959886 5:3293446-3293468 GGGTGTGTGCGGGTGTGCAAAGG - Intergenic
987871339 5:23621886-23621908 GGGTTTGTACCAGTGTCCTCAGG + Intergenic
990136279 5:52647776-52647798 TGGTTTGTCTGAGTCTGCTCAGG + Intergenic
1002452087 5:179324996-179325018 GTGTGTGTCGGGGTGTGATCGGG - Intronic
1006375380 6:33668889-33668911 CTGTGTGGCCGGGTGTGCTCAGG + Intronic
1007422856 6:41729917-41729939 GTGGTTTTCCAGGTGTGCTCTGG + Intronic
1010091049 6:71982483-71982505 GGGTTTGTTGGGGTGTGATGTGG - Intronic
1014022404 6:116606159-116606181 GGGTTTTTCTGTGTGTGATCTGG - Intergenic
1019615728 7:1959515-1959537 AGGCTTGTCCTGATGTGCTCTGG - Intronic
1020324697 7:6965329-6965351 GGGGTTGCCCTGGGGTGCTCTGG + Intergenic
1023542179 7:41277412-41277434 GGGCTTGTTCTGGTTTGCTCTGG - Intergenic
1030115214 7:106057660-106057682 GGGTGTGTGCGTGTGTGCACGGG - Intergenic
1032857205 7:135844893-135844915 TGGTTCATCTGGGTGTGCTCAGG + Intergenic
1032986451 7:137343220-137343242 AGGTTAGTTCGGGTGTGCTTAGG - Intronic
1034962951 7:155373887-155373909 GGGTGTGGCCGGGGGTGCGCGGG - Intergenic
1035584231 8:759528-759550 GGGTTGGGACGGGTGTGCACAGG + Intergenic
1036371369 8:8165612-8165634 GGGGTTATCCTGGGGTGCTCTGG - Intergenic
1036879534 8:12500032-12500054 GGGGTTATCCTGGGGTGCTCTGG + Intergenic
1042224612 8:66505493-66505515 GGCTTTGGCCGGGTGGGCTGTGG - Exonic
1043695844 8:83216260-83216282 GGGTTTCTCCGTGTTTGGTCAGG + Intergenic
1054780990 9:69165945-69165967 GGGCTCATCTGGGTGTGCTCAGG - Intronic
1057242888 9:93427932-93427954 GGCTTTGTCCAGTTGTGCACAGG + Intergenic
1061180308 9:129021603-129021625 GGGCCTGCCTGGGTGTGCTCCGG + Intronic
1203438840 Un_GL000195v1:169384-169406 GGGTCTGTCCCGGTCTTCTCGGG - Intergenic
1201604540 Y:15770914-15770936 GGGCCTGCCTGGGTGTGCTCCGG - Intergenic