ID: 1103932589

View in Genome Browser
Species Human (GRCh38)
Location 12:124458430-124458452
Sequence GCTCTTGGTGGGCCGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103932589_1103932595 -7 Left 1103932589 12:124458430-124458452 CCAGAGCCCGGCCCACCAAGAGC 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1103932595 12:124458446-124458468 CAAGAGCAGAGCCATGCTCTTGG 0: 1
1: 1
2: 1
3: 28
4: 296
1103932589_1103932597 4 Left 1103932589 12:124458430-124458452 CCAGAGCCCGGCCCACCAAGAGC 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1103932597 12:124458457-124458479 CCATGCTCTTGGCCACCTTCAGG 0: 1
1: 0
2: 4
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103932589 Original CRISPR GCTCTTGGTGGGCCGGGCTC TGG (reversed) Intronic