ID: 1103932589

View in Genome Browser
Species Human (GRCh38)
Location 12:124458430-124458452
Sequence GCTCTTGGTGGGCCGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103932589_1103932595 -7 Left 1103932589 12:124458430-124458452 CCAGAGCCCGGCCCACCAAGAGC 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1103932595 12:124458446-124458468 CAAGAGCAGAGCCATGCTCTTGG 0: 1
1: 1
2: 1
3: 28
4: 296
1103932589_1103932597 4 Left 1103932589 12:124458430-124458452 CCAGAGCCCGGCCCACCAAGAGC 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1103932597 12:124458457-124458479 CCATGCTCTTGGCCACCTTCAGG 0: 1
1: 0
2: 4
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103932589 Original CRISPR GCTCTTGGTGGGCCGGGCTC TGG (reversed) Intronic
900193197 1:1360082-1360104 GGTCTGGGAGGGCCCGGCTCTGG + Intronic
900244166 1:1629996-1630018 GCTCTGGGTGGGCTGTGATCTGG - Intronic
900418778 1:2546719-2546741 GCTCTCGGCGGCCCGGGCTCCGG - Intergenic
900497860 1:2984468-2984490 GCTCTTGGTGCACAGGTCTCCGG - Intergenic
900499886 1:2998923-2998945 CCTCTTGGTGGGCAGAGCTCTGG - Intergenic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
900736916 1:4304927-4304949 GCTGTTGTTGGGGAGGGCTCTGG + Intergenic
902482700 1:16719917-16719939 CCTCTGGGTGGGCCGGGCCAGGG - Intergenic
903270118 1:22182987-22183009 GCTCATGTTGGTCCTGGCTCCGG + Intergenic
903273635 1:22207597-22207619 GCTCCTGGGGGGCCTGGATCAGG + Intergenic
904037960 1:27568786-27568808 GCTCTTCGTGGGCGGGGAGCTGG + Intronic
906050058 1:42863512-42863534 GCCCTTGGTGGGCCGGTCGTTGG - Intergenic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
907498202 1:54859299-54859321 GATCTGGGTGGTCCTGGCTCAGG - Intronic
907892116 1:58646531-58646553 GCTCTGGATGCGCAGGGCTCTGG + Intergenic
914302411 1:146388372-146388394 GTACTTGGTGGGCAGAGCTCAGG + Intergenic
916604457 1:166327082-166327104 CCTCTTGGTGTGCAGAGCTCTGG - Intergenic
919786457 1:201261432-201261454 GCTCCTGGTGGGTGGGGTTCTGG - Intergenic
920241741 1:204557134-204557156 GCTCTTGGTGTACCAAGCTCTGG + Exonic
920531585 1:206706421-206706443 CGTCTGGGTGGGCCGGGCTTTGG + Intronic
920560046 1:206932460-206932482 GTTCTTCCTGTGCCGGGCTCTGG + Exonic
921925012 1:220704076-220704098 GCTCCTGGTGGGGTGGGCTGAGG - Intergenic
922784325 1:228275644-228275666 GCTCTGCCTGGGCCCGGCTCAGG + Intronic
1063661914 10:8040275-8040297 GCTGTTGGGGGGGCGAGCTCTGG + Intergenic
1067436563 10:46282983-46283005 GCTCGGGCTGGGCCGGGCGCCGG - Intergenic
1067448431 10:46367075-46367097 GGCCGTGGTGGGCCTGGCTCTGG + Intergenic
1067588944 10:47493691-47493713 GGCCATGGTGGGCCTGGCTCTGG - Intergenic
1067636070 10:48001782-48001804 GGCCGTGGTGGGCCTGGCTCTGG - Intergenic
1072067560 10:91885507-91885529 GCTCATGATGAGCCAGGCTCTGG - Intergenic
1072294109 10:93993624-93993646 GCTCCTGGGGCGCCCGGCTCCGG - Intergenic
1072608152 10:97000575-97000597 GCTGGTGGTAGGCCAGGCTCTGG - Exonic
1073330943 10:102669510-102669532 GCTCTAGGTGGGCCTGGGCCTGG + Intergenic
1076336355 10:129709360-129709382 GCACCTGATGGGCCGGGCACAGG + Intronic
1076830751 10:132992999-132993021 GCTGGTGCTGGGACGGGCTCAGG - Intergenic
1077191195 11:1256527-1256549 GCTCAGGGTGGGCGGGGCTGGGG - Intronic
1078508543 11:11968955-11968977 GCTCTCTGTGGGCAGGGCTGTGG - Intronic
1081811612 11:45917442-45917464 GAGCTGGGTGAGCCGGGCTCTGG - Exonic
1081845594 11:46238339-46238361 GCTCTTGGAGGCCCGGGCGGAGG + Intergenic
1081865526 11:46357664-46357686 GCTCCTGGGGGGCCGGGGCCAGG - Intronic
1084175712 11:67421213-67421235 GCTCCAGGTGGGCGGGGCGCGGG + Exonic
1084574840 11:69982413-69982435 GCTCTTGGTGGCCCCTGCCCTGG - Intergenic
1085448245 11:76615436-76615458 GCTCATGGAGGGCTGGGCCCCGG - Intergenic
1087212570 11:95458704-95458726 GCTGTTGGTGTGCCTGGGTCTGG - Intergenic
1088769479 11:113019175-113019197 GCTCTTGGTGGGCTGGCCAGAGG - Intronic
1089258037 11:117204376-117204398 GCTGGGGGAGGGCCGGGCTCAGG - Exonic
1091879161 12:3962787-3962809 GCCCTTGCTGGGCAGGGCTGTGG - Intergenic
1092844122 12:12568311-12568333 GCTCCTGGTGGACCAGGCTGAGG - Intergenic
1096615307 12:52829551-52829573 GCTTTTGATGGGCCAGGCACGGG - Intronic
1096616004 12:52834005-52834027 GGCCTTGTTGGGGCGGGCTCTGG - Exonic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1097088562 12:56487766-56487788 GCTTTGGGTGCGCCGCGCTCGGG - Intronic
1097239804 12:57567397-57567419 TCTCTGGGTGGGCGGGGCTGGGG + Intronic
1099222912 12:79935250-79935272 GCTCTTCCTGGGGCGGGCACAGG - Intronic
1099512283 12:83553289-83553311 GCTCTTGTAGGGCCGGCCTGGGG + Intergenic
1101371837 12:104137899-104137921 GCTCTTTGTGCGCCGGGCTGAGG - Intronic
1103534642 12:121626418-121626440 CTTCTTGGTGGGCGGGGCACAGG + Intergenic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1105767918 13:23579327-23579349 GCTCCTAGTGGGCGGGGCTCTGG + Intronic
1106230052 13:27814703-27814725 GCTCTAGGAGGGCAGGGCTTTGG - Intergenic
1106430832 13:29678877-29678899 CCTCTTTATGGGCCGGGCGCGGG - Intergenic
1107600985 13:42012187-42012209 GCCCAAGGTGGGCGGGGCTCTGG + Intergenic
1111936031 13:94557776-94557798 GCTCTCTGTGGTCAGGGCTCAGG + Intergenic
1112741004 13:102472561-102472583 GCTCTTGGTAGGCTGGGAGCAGG - Intergenic
1113957455 13:114106984-114107006 GCTCTGGGGGGGCCTGGCTGAGG - Intronic
1118711924 14:68526743-68526765 GCTCTTGGTGGGCCATGCAGTGG - Intronic
1118994396 14:70822885-70822907 CCCCTTGGTGGGCTGGGCTCAGG + Intergenic
1119433743 14:74584772-74584794 GATCTTGGTGAGCTGGGTTCCGG - Intronic
1121054534 14:90841874-90841896 GCAGTTGGTGGGCCGGGCACGGG + Intergenic
1122355586 14:101121225-101121247 CCTCTGGGTGGCCCTGGCTCGGG - Intergenic
1122718965 14:103711736-103711758 TCCCTTGCTGGGCCAGGCTCGGG - Exonic
1122974265 14:105164621-105164643 GCTCAAGGTGGGCCAGGCTGAGG - Intronic
1125890156 15:43259949-43259971 GCTCTGGGTGGCCCGGGAGCGGG + Intronic
1126648199 15:50895890-50895912 GCTCTTTGAGGGCAGGGATCAGG - Intergenic
1128510977 15:68313763-68313785 TCACCAGGTGGGCCGGGCTCCGG - Exonic
1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG + Intergenic
1129394581 15:75236918-75236940 GCTCTCTGTGGGCCAGGGTCAGG + Intergenic
1130046690 15:80451231-80451253 GATCCTGCTGGGCCTGGCTCAGG + Intronic
1132469363 16:93358-93380 GCTCCCGGTGGGCCAGCCTCAGG - Intronic
1132518367 16:376348-376370 GGTCCTGGTGGTCGGGGCTCGGG + Exonic
1133128886 16:3664243-3664265 GCGGTGGGTGGGGCGGGCTCCGG - Exonic
1133348165 16:5084011-5084033 GAGCTGGGTGGGCCGGGCTGCGG + Intronic
1133631993 16:7630394-7630416 GTGCTTGGTGGGCCGGGTTGTGG + Intronic
1139511840 16:67432162-67432184 GCTCTTAGAGAGCTGGGCTCAGG + Intronic
1139954251 16:70685792-70685814 GCTCTGGCTGGGCCGGGCCGCGG + Exonic
1142006015 16:87689911-87689933 GCTCCTGGAGGGCCGGGCCGGGG + Exonic
1142271876 16:89094047-89094069 GCTCTCGGGGGCGCGGGCTCCGG + Intronic
1142357427 16:89608568-89608590 GCTCTGGATGTACCGGGCTCTGG - Intergenic
1142741073 17:1932334-1932356 GCGGTTGGTGGGAGGGGCTCTGG + Intergenic
1143995953 17:11006574-11006596 GCCCTTAGTGGGCTGGGTTCAGG + Intergenic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1148157140 17:45430997-45431019 GGGCTGGGCGGGCCGGGCTCGGG - Intronic
1148875998 17:50687565-50687587 GCTCTTGCGGAGCAGGGCTCGGG - Exonic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151956896 17:77384620-77384642 ACTCTTGGTGGTTCTGGCTCAGG - Intronic
1152205034 17:78970079-78970101 GCACCTGCTGGGCCGAGCTCAGG - Intergenic
1152657327 17:81526073-81526095 GCACTAAGTGGGCCTGGCTCTGG - Intergenic
1152735613 17:81995583-81995605 GCTCGGGGTGGGCAGGGATCGGG - Intronic
1154110799 18:11566806-11566828 GCTCTCGCTGTGCAGGGCTCTGG - Intergenic
1154174533 18:12076710-12076732 GCTCCTGCTCGCCCGGGCTCTGG - Intergenic
1154266666 18:12884368-12884390 GCGCTCGGGGGGCGGGGCTCGGG + Intronic
1154315111 18:13298112-13298134 GCTGTTGAGGGGCAGGGCTCTGG + Intronic
1156504105 18:37578071-37578093 GGGCTTGGTGGGCTGGGCTCTGG - Intergenic
1157480442 18:48050381-48050403 GCTCGTGGCGGGCAGGGCACAGG - Intronic
1157547596 18:48557364-48557386 GTTCCTGGTTGGCCTGGCTCTGG - Intronic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1161256459 19:3312699-3312721 GCTCCTGGAGGGCAGGGCCCGGG - Intergenic
1161350241 19:3787032-3787054 GGTCTTGGTGGACAGGGCCCTGG + Intronic
1161587703 19:5114460-5114482 CCTGTTGGTGGGGAGGGCTCAGG - Intronic
1161600471 19:5179390-5179412 GCTCCAGGTGGGCCGGGCCCAGG - Intronic
1162001275 19:7746571-7746593 GCTCTCCCTGGGCCAGGCTCCGG - Intronic
1162003902 19:7765123-7765145 GCTCTCCCTGGGCCAGGCTCAGG + Intronic
1162907689 19:13833358-13833380 GACCTCGGTGGGCGGGGCTCTGG + Intergenic
1163325379 19:16600091-16600113 GCTCCTGGTGGGCCTGGGCCTGG - Intronic
1163420155 19:17209814-17209836 GGTCTTGGTGGGCGGGGCCTTGG + Intronic
1163715228 19:18869271-18869293 GCTCCAGGCGGGCCCGGCTCGGG + Exonic
1164282800 19:23783682-23783704 GCTCTCTGTGGGAAGGGCTCAGG - Intronic
1164947239 19:32306356-32306378 GCTCTGGGAGGGCCAGGCGCGGG - Intergenic
1165077335 19:33287139-33287161 GCTCTGTGTGGGCCGCACTCAGG - Intergenic
1165758431 19:38307412-38307434 GTTCATGGTGAGCTGGGCTCGGG - Exonic
1165892991 19:39125944-39125966 GCTTGCGGTGGGCCGGGCGCTGG + Intronic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1167006145 19:46777658-46777680 GATCTGGGTGGGCGGGGCTTTGG - Intronic
925024168 2:594842-594864 ACTCTTGAGGGGCCGGGCCCTGG - Intergenic
926113409 2:10196612-10196634 TCCCATGGGGGGCCGGGCTCCGG + Intronic
927186380 2:20485434-20485456 GCCCGTGGTGGGCCTGGCACTGG + Intergenic
927557612 2:24047218-24047240 GCTCTTGGTGGGTAGGGGGCGGG - Intronic
927692218 2:25216172-25216194 GCGCTCGGGGGGCCCGGCTCGGG + Intergenic
927847929 2:26480863-26480885 GCTCCTGCTGGGCCTGGCTGTGG - Exonic
927958666 2:27225759-27225781 GCCCTGGGTGGCCTGGGCTCTGG + Exonic
928103438 2:28452627-28452649 GCGCTTGGTGGCCCAGGCTCAGG - Intergenic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
932770730 2:74499532-74499554 GTTCATGGTCGGCCGGGCTGGGG + Exonic
933765718 2:85707158-85707180 GCTCCTGGTGGGTGGGTCTCAGG - Intergenic
935150279 2:100427709-100427731 GCTTCTGGGAGGCCGGGCTCTGG + Intergenic
935262043 2:101364063-101364085 GCACTTGGTTGGCAGGGGTCAGG + Intronic
941730086 2:168907941-168907963 GCTCTTCGTGAGTCGGGATCTGG - Exonic
942128950 2:172858463-172858485 GCTCTTTATGGGCCGGTCACTGG - Intronic
942507924 2:176663445-176663467 TTTCTTGGTGGGCCAGGATCAGG + Intergenic
944435138 2:199680945-199680967 GCTTTTGCTGGGCAGGGTTCTGG + Intergenic
944556489 2:200892273-200892295 GCGCCTGGTGATCCGGGCTCTGG + Exonic
946006242 2:216527328-216527350 GCTCCTCGGGGGCCGGGCTGAGG - Intronic
948625173 2:239264117-239264139 GCTCGTGGGGAGACGGGCTCTGG + Intronic
948898055 2:240936726-240936748 GCTCTTTGTAGGCAGGGTTCAGG - Intronic
948934267 2:241152078-241152100 TCACTTGGTGGTCCAGGCTCAGG - Intronic
1169132548 20:3173588-3173610 GCCGCTGGTGGGCGGGGCTCGGG - Intronic
1169209772 20:3759510-3759532 GCTCTTGGTGGGAGGGCCTAGGG - Intronic
1169332733 20:4729578-4729600 CTTCTTGGTGAGCCTGGCTCAGG + Intergenic
1170983678 20:21238821-21238843 GCTCTTGGAAGGCCTGGCTGAGG + Intronic
1173248060 20:41349832-41349854 GCTCTTAGGGGACTGGGCTCCGG - Exonic
1174239122 20:49118610-49118632 GCTCTTTGTGGGCAGGGGTGTGG - Intronic
1174269661 20:49358520-49358542 GCTCTTGGGGGGCAGAGCTCCGG + Intergenic
1175540490 20:59744797-59744819 GCTCTGGGTGGGCAGGGCCTGGG - Intronic
1175921146 20:62451138-62451160 GCTCTAGGTCAGCTGGGCTCAGG - Intergenic
1176025171 20:62982017-62982039 GCTCTTGGTGGGACAGACTGGGG + Intergenic
1176042321 20:63072200-63072222 CCTCCGGGTGGGCCGGGCTCGGG + Intergenic
1177549134 21:22598067-22598089 GCCCATGGTGGGGTGGGCTCGGG - Intergenic
1178843736 21:36157305-36157327 TCTCTTCGTGGGCCGGCCCCGGG - Intronic
1180796890 22:18610318-18610340 GCTCGTGGTGGCCCAGGCCCGGG + Exonic
1180918437 22:19505719-19505741 GCTTATTGTGGGCCTGGCTCTGG + Intronic
1181024506 22:20120407-20120429 GCTCCTGGTGGCCTGGGCCCAGG + Intronic
1181224834 22:21384953-21384975 GCTCGTGGTGGCCCAGGCCCGGG - Exonic
1181253798 22:21549860-21549882 GCTCGTGGTGGCCCAGGCCCGGG + Exonic
1181459674 22:23078664-23078686 GCTCTGGGTGGGCCAGGGTTTGG + Intronic
1181493496 22:23275182-23275204 TCTCCTGGTGGGCCTGGCCCAGG + Intronic
1182314279 22:29433572-29433594 GCTGTTGGTGGGCCGAGCGCAGG - Intergenic
1184109878 22:42388466-42388488 GCTGTTGGTGGGCTCTGCTCCGG - Intronic
1184697923 22:46150300-46150322 GCTCGCGGTGGGCGGGGCCCCGG - Intergenic
1185259421 22:49853541-49853563 GCTCTGGCTGGGCGGGGCGCGGG - Intergenic
1185275188 22:49947689-49947711 GCTCTGGGTGGGCGGGGAGCAGG - Intergenic
1185291649 22:50030527-50030549 GCTTTTGGCGGGCTGGGCTACGG + Exonic
950183180 3:10929136-10929158 GCTCCTGGTGGCCCAGGCTCTGG - Intronic
950429311 3:12941753-12941775 GCTCGTAGTGATCCGGGCTCAGG + Exonic
950516736 3:13471387-13471409 GCTGTGGGTGCGCAGGGCTCCGG - Intergenic
953891950 3:46757224-46757246 GCTCGTGGTGGCCCGCGCTTGGG - Intronic
954305334 3:49722559-49722581 GCTGTTGGTGGGCTGGGGTGGGG - Intronic
954367618 3:50154902-50154924 CCTGTCCGTGGGCCGGGCTCAGG - Intergenic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
954754797 3:52833336-52833358 ACTCTTGGTGGGTCCGGCTTTGG + Exonic
957625755 3:82650527-82650549 GCTCTTGGTGGGCTGGAAGCAGG + Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960819906 3:121718438-121718460 ATCCTTGGTGGGCCGTGCTCAGG - Exonic
961501296 3:127337942-127337964 GATGGTGGTGGGCTGGGCTCGGG + Intergenic
962357316 3:134705789-134705811 GCTGTTGGTGGGACAAGCTCAGG + Intronic
964408768 3:156377356-156377378 GCTCTTGGTTCGCATGGCTCGGG - Intronic
969365110 4:6689790-6689812 GCTCTTGCTGGGCCGCACCCAGG - Intergenic
977004951 4:91555150-91555172 GCTCTTTGTTGGCTGTGCTCTGG - Intronic
978892938 4:113851830-113851852 TCTCTTGGTGGGTCTGACTCAGG + Intergenic
981532095 4:145762869-145762891 GCTCCTGCAGGGCAGGGCTCAGG + Intronic
985542511 5:493485-493507 GCTCTTGCAGGGCCGGGTGCTGG + Intronic
985890086 5:2708626-2708648 GCTCTTGGGGGCCTTGGCTCTGG - Intergenic
988519869 5:31936077-31936099 GCTGTGGGTGGGTGGGGCTCTGG + Intronic
990435297 5:55784183-55784205 CCTCTTGGTGGGGCGGAGTCAGG + Intronic
991342963 5:65632133-65632155 CCTCTTGGTGGGCGGGGGTAGGG + Intronic
991559332 5:67932947-67932969 GATCTTGGTGGTGCTGGCTCTGG + Intergenic
991979738 5:72218664-72218686 GCTCTTGGTGCCCTGGCCTCTGG - Intergenic
994263414 5:97686110-97686132 CCCCTTGCTGGGCAGGGCTCAGG + Intergenic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
999295988 5:150459723-150459745 TCTCGAGGTGGGCAGGGCTCAGG + Intergenic
1001269076 5:170297473-170297495 GCCCTTGGTGGGCTGAGCTGAGG - Intronic
1002270233 5:178067042-178067064 GAGCTTGGTGGCCCGAGCTCTGG - Intergenic
1006025660 6:31145172-31145194 GCAGGAGGTGGGCCGGGCTCGGG - Exonic
1006359712 6:33580318-33580340 GATCTGGGTGGGCCAGGCCCAGG + Intergenic
1006796765 6:36737130-36737152 GCTGGTGGTGGGCCGGGGCCCGG + Intergenic
1007711869 6:43829620-43829642 GCCCTTTGTGGGCCAGGCTGTGG - Intergenic
1008175244 6:48260723-48260745 TTTCTTGGTGGGCAGGGATCTGG - Intergenic
1012240441 6:96865116-96865138 GCTCTTCTTGGGCTGAGCTCTGG + Intergenic
1013130016 6:107223761-107223783 GCTCTTGGTGGGTCGGGGTCGGG - Intronic
1016190607 6:141260783-141260805 GGTCTTGGGGGGCCGGGAGCAGG + Intergenic
1018956809 6:168415818-168415840 TCTCTTGGGGCGCCAGGCTCTGG - Intergenic
1019898007 7:3998060-3998082 GCTCTTGGCGGGCTGGGAGCAGG - Intronic
1021558539 7:21945862-21945884 GTTCTTGGTGCGCCGGGCCGTGG - Exonic
1023082239 7:36536502-36536524 GTTCATGCTGGGCCGGCCTCAGG - Intronic
1023613157 7:41992033-41992055 GCTCTTGGTTGCCTGGGATCTGG - Intronic
1025161227 7:56662935-56662957 GCTCCTTGTGGGCAGGGCCCAGG - Intergenic
1026994459 7:74606537-74606559 GCGCCAGGTGGGCCGGGCCCGGG - Intergenic
1029156435 7:98520920-98520942 GCTGGGGGTGGGCGGGGCTCTGG + Intergenic
1029156444 7:98520942-98520964 GCTGGGGGTGGGCAGGGCTCTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037793228 8:21966853-21966875 TCTCTAGTTGGGCCAGGCTCTGG - Exonic
1037980110 8:23247040-23247062 GCTCTCGGAGGGCCGGGCCCTGG + Intronic
1042877486 8:73452366-73452388 GCACTGGGTGGGCTGGGCCCAGG - Intronic
1045555843 8:103213697-103213719 GCTCTTAGTAGGCAGGGCTCAGG + Intronic
1049113997 8:140670156-140670178 GATATTGAGGGGCCGGGCTCAGG - Intronic
1049700167 8:144007280-144007302 GCTCCTGGTTGGCAGGGCCCTGG + Intronic
1051001977 9:12293242-12293264 TTTCTTGGTGGGCAGGGCTCAGG - Intergenic
1051160619 9:14203632-14203654 GCCCTTGGTGAGGCGGGCCCAGG - Intronic
1057230672 9:93319648-93319670 GCTCCAGATGGGCCGAGCTCAGG + Intronic
1057303094 9:93897576-93897598 CCCCTTGGGGGCCCGGGCTCAGG - Intergenic
1058883043 9:109302038-109302060 ACTCTTGGTGGCCAGAGCTCTGG - Intronic
1059998201 9:119934137-119934159 GCTCTTTGAGGGTGGGGCTCTGG + Intergenic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1060424647 9:123494084-123494106 GCTTTGAGTGGGCAGGGCTCAGG + Intronic
1061285545 9:129620426-129620448 GCTCTGGGCGCGCGGGGCTCCGG - Exonic
1061402326 9:130375354-130375376 GCGTTTGGAGAGCCGGGCTCTGG + Intronic
1061559837 9:131394780-131394802 GCGCGGGGTGGGCCGGGCCCCGG + Intronic
1061578170 9:131520698-131520720 GCTCGGGGTGGGGCGGCCTCTGG - Intronic
1061580167 9:131531354-131531376 GCTCCTGGTGTGCCGGCCTCGGG - Intergenic
1061969416 9:134035811-134035833 GCTCTGGCTGGGTGGGGCTCAGG + Intronic
1061972535 9:134052768-134052790 GCACTTGGTGGCCTGGGCTCTGG - Intronic
1062091584 9:134681226-134681248 GTTCTTGAAGGGCCGGGCTGAGG - Intronic
1062103682 9:134741172-134741194 GCCTGCGGTGGGCCGGGCTCAGG + Intronic
1062495350 9:136828921-136828943 GCCCTGGGTGTGTCGGGCTCAGG - Intronic
1062495593 9:136830124-136830146 GCTCCTGGTGCTCCGGGCACTGG - Intronic
1062574691 9:137200683-137200705 GCCCTGGGGCGGCCGGGCTCGGG - Exonic
1203793286 EBV:162929-162951 GCTCTGCGAGGGCCGGGCCCCGG - Intergenic
1186883065 X:13885683-13885705 GCCCTTGGTGGGGCGGGGACGGG - Intronic
1187415826 X:19092565-19092587 TCTCTTGCTGGGCCAGGCTATGG - Intronic
1189821398 X:44873022-44873044 GGCCTCGGTGGGCGGGGCTCGGG + Intergenic
1189909592 X:45796659-45796681 GCTCCTGGAGGGCCTGGGTCAGG - Intergenic
1191611221 X:63115369-63115391 GCTCATGGTGGGATGGGCTGTGG - Intergenic
1194539667 X:95155668-95155690 GGCCTTGGTGGGGTGGGCTCAGG - Intergenic
1196209807 X:112982921-112982943 GCCTTTGATGGGCCTGGCTCAGG + Intergenic
1197728897 X:129794047-129794069 GCTGGTGGAGGGCGGGGCTCAGG - Exonic
1200746888 Y:6910994-6911016 GTGTTTGGTGGGCCGGGCGCGGG + Intronic