ID: 1103932663

View in Genome Browser
Species Human (GRCh38)
Location 12:124458794-124458816
Sequence GACTAGTATTTCCGGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103932656_1103932663 -7 Left 1103932656 12:124458778-124458800 CCACCCCTAGGCTTGGGACTAGT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1103932657_1103932663 -10 Left 1103932657 12:124458781-124458803 CCCCTAGGCTTGGGACTAGTATT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1103932650_1103932663 10 Left 1103932650 12:124458761-124458783 CCAGGTCCCATGCAGGACCACCC 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1103932648_1103932663 17 Left 1103932648 12:124458754-124458776 CCAAGGGCCAGGTCCCATGCAGG 0: 1
1: 0
2: 2
3: 42
4: 338
Right 1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1103932653_1103932663 3 Left 1103932653 12:124458768-124458790 CCATGCAGGACCACCCCTAGGCT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1103932652_1103932663 4 Left 1103932652 12:124458767-124458789 CCCATGCAGGACCACCCCTAGGC 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103932663 Original CRISPR GACTAGTATTTCCGGTGGAT GGG Intronic
907401320 1:54226587-54226609 GACTAGCTTTTCTGGTGGAAGGG + Intronic
921952085 1:220940754-220940776 CACTAGTCTTTCAGGTGGTTGGG + Intergenic
1067152757 10:43750001-43750023 GACTAGAAGTTCCACTGGATTGG + Intergenic
1075236256 10:120732304-120732326 GACTAGTTTGGCCAGTGGATTGG - Intergenic
1098136960 12:67413015-67413037 GGGTAGGATTTCCGGTGGAATGG + Intergenic
1103932663 12:124458794-124458816 GACTAGTATTTCCGGTGGATGGG + Intronic
1110598081 13:77340967-77340989 GACTAGTGGTTCCAGTGGCTGGG + Intergenic
1111515462 13:89325278-89325300 GACTAGAATTTCTGGCAGATAGG + Intergenic
1114558329 14:23575152-23575174 GACTATCTTTTCAGGTGGATAGG + Intronic
1140580156 16:76222054-76222076 GAATACTATTTCAGATGGATAGG - Intergenic
925737012 2:6972442-6972464 GAATAATTTTTCAGGTGGATTGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
932292374 2:70593564-70593586 GACTAGGATATCCGGTACATGGG - Intergenic
1177656734 21:24026541-24026563 TACTAGTATTTCCTGTGAGTTGG + Intergenic
1179626959 21:42654180-42654202 GCCTTTAATTTCCGGTGGATCGG + Intronic
1181177589 22:21046360-21046382 GCTTAGTTTTTCCTGTGGATTGG - Intronic
955532307 3:59886783-59886805 GACTAGTAATTGCTGTGGTTTGG - Intronic
961929625 3:130519014-130519036 CAATAGTATTTCCGGAGAATTGG - Intergenic
972123092 4:35729940-35729962 GAGTAGTATTTCAGGTTAATTGG - Intergenic
973093058 4:46162564-46162586 GACCAGTATTCTCTGTGGATTGG + Intergenic
974941476 4:68474366-68474388 GAGTAGTATTTCCCATGGAGGGG + Intronic
992131023 5:73692955-73692977 GACTAATATTTCGAGTTGATGGG - Intronic
994000411 5:94772807-94772829 GACTAGGTTTTCCGGGGGAAGGG - Intronic
996152730 5:120059612-120059634 GACTTGTAGTTCCAGTGGCTGGG + Intergenic
998122093 5:139587172-139587194 GACTAGTGTTCCAGCTGGATAGG + Intronic
1004815754 6:19310330-19310352 AACCAGTATTTCCAGTGCATTGG + Intergenic
1017184853 6:151590331-151590353 GGCAAGAATTTCAGGTGGATTGG + Intronic
1028012665 7:85667921-85667943 GACTAGTATATCCAGTGTCTAGG - Intergenic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1037071748 8:14659143-14659165 AACTAGTATTTCCAGAGGTTTGG - Intronic
1037873328 8:22521080-22521102 GACAAGTATGTCCCATGGATGGG + Intronic
1037924036 8:22830718-22830740 GACAAGAATTGGCGGTGGATTGG - Intronic
1042014690 8:64295479-64295501 GAACAGTATTTCCTGAGGATTGG - Intergenic
1058007547 9:99934309-99934331 GAATAATAATTCAGGTGGATAGG + Intronic
1186668162 X:11740290-11740312 GAATAGTATTTCAGCTGGATAGG - Intergenic
1190538459 X:51453182-51453204 CTCTAGTATTTCCTGTGAATAGG + Intergenic
1191031446 X:55977907-55977929 GACTATTATTTGTGCTGGATTGG + Intergenic
1191586961 X:62838072-62838094 GAGTATTATTGCCGGTGGACTGG - Intergenic