ID: 1103937223

View in Genome Browser
Species Human (GRCh38)
Location 12:124483092-124483114
Sequence TGCACAGCAGGCAGCCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103937223_1103937229 -9 Left 1103937223 12:124483092-124483114 CCCAGGGGGCTGCCTGCTGTGCA 0: 1
1: 1
2: 2
3: 33
4: 264
Right 1103937229 12:124483106-124483128 TGCTGTGCAGGGCTCGAGGCAGG 0: 1
1: 0
2: 0
3: 27
4: 276
1103937223_1103937231 -7 Left 1103937223 12:124483092-124483114 CCCAGGGGGCTGCCTGCTGTGCA 0: 1
1: 1
2: 2
3: 33
4: 264
Right 1103937231 12:124483108-124483130 CTGTGCAGGGCTCGAGGCAGGGG 0: 1
1: 1
2: 1
3: 33
4: 330
1103937223_1103937230 -8 Left 1103937223 12:124483092-124483114 CCCAGGGGGCTGCCTGCTGTGCA 0: 1
1: 1
2: 2
3: 33
4: 264
Right 1103937230 12:124483107-124483129 GCTGTGCAGGGCTCGAGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 304
1103937223_1103937233 24 Left 1103937223 12:124483092-124483114 CCCAGGGGGCTGCCTGCTGTGCA 0: 1
1: 1
2: 2
3: 33
4: 264
Right 1103937233 12:124483139-124483161 CCCCCTGTTCCAAGCAAGCATGG 0: 1
1: 0
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103937223 Original CRISPR TGCACAGCAGGCAGCCCCCT GGG (reversed) Intronic
900290834 1:1922941-1922963 GGGACACCAGGCAGCCCCCTCGG - Intronic
900519506 1:3098790-3098812 TGCAGAGCTGGCTGCCTCCTTGG + Intronic
900938276 1:5780838-5780860 TGCAGAGGGGGCTGCCCCCTTGG + Intergenic
901530029 1:9846914-9846936 CACACAGCAGGCAACCTCCTGGG - Intergenic
901633469 1:10658989-10659011 TCCAAGGCATGCAGCCCCCTGGG + Intronic
902698409 1:18155571-18155593 TGCACAGCATGCAGGGCCCCGGG + Intronic
903228985 1:21910387-21910409 AGCACAGGAGGCAGCCCTGTGGG - Intronic
903277050 1:22228971-22228993 TGCACACCTGGCGGCCCCATGGG + Intergenic
903335305 1:22620500-22620522 TGCACACCAGGCTGCCCCTGTGG - Intergenic
903576888 1:24344887-24344909 TTCATTGCAGGCAGCCCCCTCGG + Exonic
904258367 1:29271990-29272012 TGCACACAGGGCAGCCACCTCGG + Intronic
906107975 1:43305978-43306000 AGCTCAGGAGGCAGCCCCCTTGG - Intronic
907273316 1:53303339-53303361 TGTTCAGCCTGCAGCCCCCTTGG - Intronic
908961118 1:69697883-69697905 TGTACAGCAGTAAGCCCCATGGG - Intronic
909088242 1:71193278-71193300 TGGACACCAGGCATCTCCCTTGG + Intergenic
910505358 1:87944401-87944423 TGCACATCAGTCAGCACCCTGGG - Intergenic
915462799 1:156080273-156080295 TGCACAGCCCTCATCCCCCTGGG - Intronic
917001651 1:170367551-170367573 TGCACTGCAGGCTGCCTCCAGGG + Intergenic
917496131 1:175541715-175541737 TCCACACCTGGCATCCCCCTTGG - Intronic
918114135 1:181482689-181482711 TTCCCCGCAGGCAGCGCCCTCGG - Intronic
919856825 1:201711805-201711827 TTCACATCAGGCACCACCCTGGG - Intronic
920053219 1:203175714-203175736 TGGACTGCAGGCAGGGCCCTCGG + Exonic
920563359 1:206955218-206955240 TGCACAGCAGGCACTATCCTAGG - Intergenic
920737071 1:208542556-208542578 TGGACAGCAGCCAGCCCCTAAGG + Intergenic
922034612 1:221836117-221836139 TACACAGGAGGCAGCCCCCTAGG + Intergenic
922041579 1:221903250-221903272 TGCACTGCAAGCAGCTTCCTTGG + Intergenic
922579658 1:226687532-226687554 TTTACAGCGGGCAGCACCCTTGG - Intronic
923545075 1:234918052-234918074 TGCTCTGCAGGCAGCGACCTGGG - Intergenic
923686236 1:236155556-236155578 AGCCCAGCAGGCAGCCCGCGAGG - Intronic
1062818684 10:518354-518376 TGCACCGCTGGCAGCTCCCCTGG + Intronic
1062995512 10:1862556-1862578 TGCACAGCAGGAAATCACCTTGG - Intergenic
1064974618 10:21100530-21100552 TGCACAGAGGTCAGCCCCCCAGG - Intronic
1065815535 10:29479493-29479515 TGCACAGCACACAGCCCCACTGG + Intronic
1065957402 10:30705728-30705750 TGCACAGCACACAGCCCCACTGG - Intergenic
1067205674 10:44209983-44210005 TGCACAGCGGGCAGCAGGCTGGG + Intergenic
1067278672 10:44855248-44855270 TGGACCGCAAACAGCCCCCTGGG + Intergenic
1068721613 10:60252119-60252141 TGCACAGGTGTCAGCCCCTTTGG - Intronic
1071956845 10:90770026-90770048 TGCAGAGCAGTCAGCTGCCTTGG - Intronic
1074395642 10:113095847-113095869 GGCACAGCTTGCAGCACCCTGGG - Intronic
1075709135 10:124521378-124521400 TGCACAGCGGTGAGCCCCCCAGG + Intronic
1075724477 10:124604408-124604430 TGGACAGCAGGGAACCCCATGGG + Intronic
1075733745 10:124651686-124651708 TCCAGAGCAGGCAGGCCCCAGGG - Intronic
1075893449 10:125974310-125974332 TGCACTGCAGGAAGACCCCTGGG + Intronic
1075944491 10:126420659-126420681 GGTAAAGCAGGCAGCCCCGTTGG + Intergenic
1075995330 10:126872238-126872260 TGCTCACCAGCCAGCCCCCCAGG - Intergenic
1076417243 10:130300723-130300745 AGGACAGCAGGCAGGCCCCGGGG - Intergenic
1076661568 10:132059092-132059114 TGCACAGGAGACAGCATCCTGGG - Intergenic
1077065795 11:640396-640418 AGCACAGCAGGAAGGCCCCTGGG - Exonic
1077143713 11:1035770-1035792 TCCACAGCCGGGAGCCCCCTGGG - Intronic
1077289350 11:1781773-1781795 TGGGCAGCTGACAGCCCCCTGGG - Intergenic
1079100521 11:17538796-17538818 GGCCCAGCAGCCAGCCCCCAGGG - Intronic
1080638384 11:34143159-34143181 TGCACAGAAGGCAGCCTGCCTGG - Intronic
1083203361 11:61132984-61133006 AGCACAGCAGGAGGCCCCCAGGG - Intronic
1083915434 11:65740206-65740228 TTCACTGCTGGCTGCCCCCTGGG - Intergenic
1085644628 11:78214972-78214994 ATCACAGCAGGCAGCCCCTGGGG - Intergenic
1088719465 11:112579306-112579328 TGCCCAGCAGGCACCCTCCTAGG - Intergenic
1089572537 11:119419979-119420001 GGGACAGCAGGCAGTTCCCTTGG - Intronic
1092299431 12:7231445-7231467 TCCACAGCACTCAGCCCCTTGGG + Intergenic
1100442168 12:94627294-94627316 TGCACAGCTGTCAGCACACTAGG + Intronic
1101079668 12:101170415-101170437 TGCAAAGAAGGCAGCCCGCTAGG + Intronic
1101080023 12:101172668-101172690 TGCAAAGAAGGCAGCCCGCTAGG + Intronic
1102219634 12:111185843-111185865 TACATTGCAGGCAGCCCCCTCGG - Intronic
1102456196 12:113072096-113072118 TGGAGAGCAAGCAGCCCCCAGGG - Intronic
1103937223 12:124483092-124483114 TGCACAGCAGGCAGCCCCCTGGG - Intronic
1104024479 12:125015813-125015835 TGTGCACCTGGCAGCCCCCTGGG + Intronic
1104986622 12:132601047-132601069 AGCCCAGCAGGCAGCCCCCAGGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106185151 13:27403373-27403395 TGCACAGCAGCCAGATCTCTGGG + Intergenic
1112503458 13:99959045-99959067 TGCCCAGCCGGCCGGCCCCTCGG - Intergenic
1112771564 13:102799546-102799568 CGCACAGCCGGCCGCCACCTCGG - Intronic
1113025484 13:105936712-105936734 TGCACAGCAGGCAGCAGGCTTGG - Intergenic
1114507926 14:23232520-23232542 TGCCCAGCAGCCACCCCTCTGGG + Intronic
1114556721 14:23566478-23566500 CCCACAACAGGCAGTCCCCTGGG + Intronic
1117088927 14:52229955-52229977 TGCAAAGCAGGAAGCACCCCAGG - Intergenic
1117885882 14:60362379-60362401 TACACAGGAGGCAGCATCCTTGG + Intergenic
1118315839 14:64725597-64725619 TGCTCAGAAGAGAGCCCCCTGGG - Intronic
1119747277 14:77053261-77053283 TCCCCAGCAGGCAGCCCTCTGGG - Intergenic
1121738303 14:96234226-96234248 CGAAGAGCAGGCAGCACCCTGGG + Intronic
1121877495 14:97466951-97466973 TGCACAGAAGGGTGCCCCCTTGG + Intergenic
1122573709 14:102726840-102726862 TTCAGAGCAGGCAGTCTCCTTGG + Exonic
1122898837 14:104773754-104773776 CCCACAGCAGGCAGCTGCCTGGG + Intronic
1122962606 14:105103160-105103182 AACACAGAAGTCAGCCCCCTAGG - Intergenic
1124370966 15:29104382-29104404 TGCACAGCTGCCAGCCTGCTTGG + Intronic
1124605981 15:31170684-31170706 TGGTCCTCAGGCAGCCCCCTGGG - Intergenic
1127963690 15:63908459-63908481 TGCACAGAAGGGAGCCCCGCTGG + Exonic
1128671441 15:69577284-69577306 GACACTGCAGGCAGCCACCTTGG + Intergenic
1129169473 15:73798890-73798912 GGCTCAGCAGTCAGACCCCTGGG - Intergenic
1129694444 15:77732715-77732737 TGCAGAGCAGGGAGCCACCATGG - Intronic
1129803934 15:78438486-78438508 GGCCCAGCAGGCAGGCCCCGAGG - Intronic
1129883323 15:79021330-79021352 TGCAGAGCAGGCTGCCCCTTGGG + Intronic
1130821444 15:87500409-87500431 TGCAGAGCCTGCAGCCCCCTGGG - Intergenic
1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG + Exonic
1131112961 15:89776831-89776853 GGCACAGCGGGCAGCCCCAAGGG - Exonic
1131970233 15:97884699-97884721 TGCAAAGCAGCCAGCCCTGTTGG - Intergenic
1132304505 15:100801650-100801672 TGCACAGAAGGGAGCCCCGGGGG - Intergenic
1132331579 15:101015668-101015690 TACACACCAGGCAGTGCCCTAGG + Intronic
1133130509 16:3673674-3673696 TGCACAGCTGGCATCCATCTTGG - Intronic
1135538495 16:23312479-23312501 TGCACAGCATGCTGACCCCCAGG + Intronic
1136117149 16:28101709-28101731 TGAGCAGCAGCCAGCCCCCAGGG + Intronic
1136271005 16:29148233-29148255 AGCCCAGGAGGCAGCCCCCCGGG - Intergenic
1136990109 16:35146854-35146876 CGGAAAGCAGGCAGCTCCCTGGG - Intergenic
1139281346 16:65773540-65773562 GGGACAGCAGGGAGCCACCTGGG - Intergenic
1139436799 16:66941168-66941190 TGCCCCGCAGGCAGCCCACCAGG - Exonic
1141998979 16:87653217-87653239 TTCAGAGCAGGCATCACCCTGGG - Intronic
1143502722 17:7348403-7348425 GGCACAGGAGGCTGCCCCCTTGG - Exonic
1143731861 17:8886096-8886118 TGCACAGGAGGTAGGCCCCTGGG - Intronic
1144505722 17:15828944-15828966 GCCACACCAGGCAGCCCTCTTGG + Intergenic
1144753166 17:17663960-17663982 TGCACAGCTGGGAGCTCCCCTGG - Intergenic
1144758990 17:17696710-17696732 TCCACACTAGGCAGCCTCCTGGG - Intronic
1145120508 17:20255323-20255345 AGCACAGCAGGAAGCCCACTTGG + Intronic
1145169897 17:20646876-20646898 GCCACACCAGGCAGCCCTCTTGG + Intergenic
1145784062 17:27582752-27582774 TGCCCAGCTGGGAGCTCCCTGGG - Exonic
1145796637 17:27659307-27659329 TGCCCTGCATGCTGCCCCCTGGG - Intergenic
1145902069 17:28495869-28495891 TGCCCAGCAGGCAGAACCCCTGG - Intronic
1147156022 17:38544857-38544879 TGAAAAGCGGGCAGCCACCTGGG + Intronic
1147984945 17:44300506-44300528 GGCACACCAGGGAGTCCCCTGGG - Intergenic
1149042081 17:52202265-52202287 TGCAGAGCAGGCAGCCCTCTGGG - Intergenic
1151256169 17:72878411-72878433 TTCACAGCAAGAAGGCCCCTGGG - Intronic
1151683881 17:75635761-75635783 GGCAGAGCAAGCAGCCCTCTGGG + Intronic
1151819084 17:76487660-76487682 GGCACAGCAGCCAGCGCCCTGGG + Intronic
1152305711 17:79519193-79519215 TGAAGGGCAGGCAGCCCTCTCGG + Intergenic
1152341682 17:79729191-79729213 TGCAGAGCAGGCACCCCACGCGG + Intergenic
1157244309 18:46040078-46040100 GGAACAGAAGGCAGCCCCCAAGG + Intronic
1157560046 18:48639432-48639454 TGAACTCCAGGCTGCCCCCTGGG - Intronic
1159988939 18:74879386-74879408 CGCACAGCAGGCAGCACCCACGG + Intronic
1162849124 19:13417109-13417131 GGAACATCAGGCTGCCCCCTTGG - Intronic
1162934140 19:13972790-13972812 TGCCCAGCATGTAGCCGCCTTGG + Exonic
1167000380 19:46742286-46742308 GGCAGAGAAGGCAGCCCCCAGGG - Intronic
1168278397 19:55289659-55289681 TGCCCAGCAGACAGGCCCTTGGG + Intronic
1168470673 19:56638283-56638305 AGCACCACAGGCAGCCCCCCAGG + Intergenic
925768127 2:7257596-7257618 AGCATTGCAGGCACCCCCCTGGG - Intergenic
926146497 2:10399735-10399757 TGTACAGCAGGCCGCTCCCCGGG + Intronic
928412645 2:31066673-31066695 CACAGAGCAGGCAGCCCCCAGGG + Intronic
928615271 2:33031925-33031947 TGCCCAGCAGCCAGCCTCCCAGG - Intronic
928984536 2:37167972-37167994 TGCTTAGCAGGCACCTCCCTCGG - Exonic
934132046 2:88957496-88957518 TTATCAGCAGGCAGCCCCCAAGG - Intergenic
934133557 2:88972141-88972163 TTATCAGCAGGCAGCCCCCAAGG - Intergenic
937025465 2:118693541-118693563 CTCACAGCAGGCAGCCCAGTGGG - Intergenic
938131182 2:128716698-128716720 TTCACAGCAGGCAGCCTCGCGGG - Intergenic
939596705 2:144134097-144134119 AGGACAGAAGGCAGCCCCCGTGG - Intronic
941097091 2:161250643-161250665 TGTACAGCAGGCAGAACCCCAGG - Intergenic
941116714 2:161480349-161480371 TGCCCAGCAGACATGCCCCTAGG + Intronic
941395433 2:164967947-164967969 TTAACAGCTGGCAGCCTCCTAGG - Intergenic
942303525 2:174585117-174585139 TGCACTGCAGGCAGAGACCTGGG + Intronic
946025860 2:216671304-216671326 TGCACAGCACACTGCCCCTTAGG - Intergenic
947972204 2:234333675-234333697 TGCAGAGCCTGCAGCCCCCACGG - Intergenic
948097520 2:235348268-235348290 TGCACAGAAGGCTGACACCTAGG + Intergenic
948480952 2:238250115-238250137 TGCAGAGCAGCCCGCTCCCTGGG + Intronic
948550946 2:238772741-238772763 TGCACACCAGGCAGATCCGTAGG + Intergenic
948831926 2:240602497-240602519 AGCCCTGCAGGCAGGCCCCTTGG + Intronic
1169414363 20:5403245-5403267 TCCACAGCAGGCGTCTCCCTGGG + Intergenic
1171166158 20:22973771-22973793 TGCCCAGCTTGCAGCCCACTCGG + Intergenic
1171176915 20:23058368-23058390 TGCCCAGCAGGCAGCCTCTGGGG - Intergenic
1171431392 20:25085042-25085064 GGCTCAGCAGGCACCCCTCTTGG + Intergenic
1173495288 20:43514043-43514065 TGACCCGCAGGCCGCCCCCTGGG - Exonic
1173549700 20:43924027-43924049 TGAACAGCAGGCAGTTCCCTTGG + Intronic
1173806212 20:45927042-45927064 GCCACAGCAGGCAGCCCACAGGG + Intergenic
1174062488 20:47842750-47842772 CTCTCAGCAGGCAACCCCCTGGG + Intergenic
1174073145 20:47912747-47912769 CTCTCAGCAGGCAACCCCCTGGG - Intergenic
1174150923 20:48485900-48485922 CTCTCAGCAGGCAACCCCCTGGG + Intergenic
1175413619 20:58787273-58787295 TGCACTGCAGGGAGCCCCAGGGG - Intergenic
1175751466 20:61501005-61501027 TCCACAGCAGGCAGGCCCTTGGG + Intronic
1175869729 20:62202903-62202925 TGCACAGCAGGCCGGTGCCTGGG + Intronic
1175964656 20:62654482-62654504 GGGACAGCAGGCAGTCCCGTGGG - Intronic
1176031194 20:63012992-63013014 TGCAGAGCAGACACCTCCCTGGG - Intergenic
1176342168 21:5709299-5709321 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1176474422 21:7141451-7141473 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1176502659 21:7615157-7615179 AGCAGAGCAGGCGGCTCCCTGGG - Intergenic
1176536489 21:8107368-8107390 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1177677317 21:24317346-24317368 TGCAGAGCAGGCTGCCCCGTAGG + Intergenic
1178663333 21:34524801-34524823 TGCTCAGGGGACAGCCCCCTAGG + Intronic
1178703375 21:34852983-34853005 TGCACAGCACGTAGCCGCCGGGG - Intronic
1179728760 21:43355673-43355695 TGGTGAGCCGGCAGCCCCCTCGG + Intergenic
1180158988 21:45990639-45990661 TGCCTAGCAGACACCCCCCTGGG - Intronic
1181267055 22:21636545-21636567 GACCCAGCAGGCAGCCTCCTTGG + Exonic
1182150880 22:28026318-28026340 TGCCCAGCAGACAGCCTCCTGGG + Intronic
1182238517 22:28895938-28895960 TGAACAGCAGACAGCCTTCTGGG - Intronic
1182500606 22:30743983-30744005 TGCCCAGAAGGCTGCCCTCTTGG - Intronic
1183276263 22:36900147-36900169 TGCACTGTAGGCTGCCCCATGGG + Intergenic
1183591366 22:38781100-38781122 TGGACAGCAGGTAGCCTCCCTGG + Intronic
1183948777 22:41341125-41341147 TGCTCAGAAACCAGCCCCCTCGG + Exonic
1184308810 22:43628008-43628030 TGCACCCCAGGAGGCCCCCTCGG - Intronic
1203241434 22_KI270733v1_random:23780-23802 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
950332426 3:12167091-12167113 GGCTCAGCAGACAGACCCCTGGG + Intronic
950469796 3:13177533-13177555 GCCACAGCAGGCAGCCACATGGG + Intergenic
951027050 3:17841368-17841390 TGCGCATCAGGCAGCTTCCTAGG - Intronic
951848112 3:27106191-27106213 CGCCCAGCAGGCTGCCCACTAGG - Intergenic
953392377 3:42541005-42541027 GGGACAGAGGGCAGCCCCCTTGG + Intergenic
956856815 3:73283152-73283174 GGCATAAAAGGCAGCCCCCTGGG + Intergenic
960054488 3:113267507-113267529 AGGACAACAGGCAGCACCCTAGG - Intronic
960271189 3:115676339-115676361 CACAGAGCAGGCAGCCCCCCAGG + Exonic
960639162 3:119810335-119810357 TGTGCAACAGGCAGCCACCTGGG + Intronic
960952073 3:123005809-123005831 TGCATGGTAGGCAGGCCCCTGGG - Intronic
961158135 3:124698175-124698197 TTCACAGCAGCCAGCAGCCTGGG - Intronic
961453335 3:127012436-127012458 TGGACAGCAGCCAGCCTCATGGG + Intronic
961613848 3:128163308-128163330 TGCACAGCATGCATCCCTCTTGG + Intronic
962866696 3:139453216-139453238 TGCCCAGCCCTCAGCCCCCTTGG + Intronic
965872782 3:173280703-173280725 TTAACAGCAGGCAACACCCTCGG + Intergenic
966885916 3:184378103-184378125 TGCACAGCAGGCAGCCCTCTGGG + Exonic
967121829 3:186389154-186389176 AGCCCAGAAGGCAGCCCCCGTGG + Intergenic
967708642 3:192680592-192680614 TGCACAGCAGGAAACCCAATAGG + Intronic
968293258 3:197555150-197555172 TGGACAGCAGGCAGGCCACAGGG - Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968613753 4:1568347-1568369 TGCACAGAAGGGAGCTCCCGCGG - Intergenic
969122667 4:4921344-4921366 TGCACAGCAGACAGCCACTGGGG + Intergenic
969423670 4:7111544-7111566 GGCAAACCAGGCAGCCCCATGGG + Intergenic
969534297 4:7746499-7746521 AGCACAGCAGGCCGTCCGCTGGG - Intergenic
969621374 4:8280552-8280574 TACAAAGCAGGCGGCTCCCTTGG - Intronic
970673345 4:18420314-18420336 TGAACTGCAGACAGCCCCTTGGG - Intergenic
970885522 4:20984062-20984084 TGCAAAGCCGGCGGCCCCCCGGG + Intronic
971387126 4:26151129-26151151 AGCAGAGCAGGCAGCCCACCTGG + Intergenic
972022021 4:34327108-34327130 AGCAGAGCAGGCAGCCACCTTGG + Intergenic
972995067 4:44869823-44869845 TGCCCAGCAGACAGCTCCTTGGG + Intergenic
974012105 4:56616442-56616464 TGCCCAGCAAGCAGCCTCTTAGG - Intergenic
974273293 4:59680621-59680643 TGCACAGCAGGCAGGCACCGTGG + Intergenic
974305012 4:60125041-60125063 TACAGAGCAGGCAGCCGCCCTGG + Intergenic
979508462 4:121524949-121524971 TCCACAGAAGGCTGCCTCCTAGG - Intergenic
980007698 4:127560063-127560085 TGCACTGCAGGCAGCTTCCATGG - Intergenic
981209235 4:142082467-142082489 TGCAGACCAGGCACCCCCCTTGG - Intronic
982313516 4:154009333-154009355 AGCACAGCAGGCAACCGCCAGGG + Intergenic
983519910 4:168697386-168697408 TGCACAGCTGTCACCCTCCTGGG - Intronic
984203224 4:176753403-176753425 TGCTCAGCAGGCAGCTCTTTTGG + Intronic
985381440 4:189399080-189399102 AGCAGAGCAGGCTGCCCCCAGGG - Intergenic
986189560 5:5482538-5482560 TGCACACGTGGCAGCCCACTAGG - Intronic
986272768 5:6248495-6248517 TGTACAGTAGGCAGCTCCTTCGG + Intergenic
986429652 5:7669019-7669041 GGCACAGCAGGCAGCCATCCTGG + Intronic
986940602 5:12944663-12944685 AGCAAAGCAGGCAGACTCCTTGG + Intergenic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
990323469 5:54651691-54651713 TCAACACCAAGCAGCCCCCTGGG + Intergenic
994171510 5:96662988-96663010 TGCCCACCTGGCAGCCGCCTTGG + Intronic
997199637 5:132002125-132002147 GGGACAGCAGGCAGGACCCTAGG + Intronic
997733084 5:136194640-136194662 AGCAGACCAGGCAGCCCTCTAGG - Intergenic
998457905 5:142287855-142287877 GGCCCAGCAGGCTGGCCCCTCGG + Intergenic
998505375 5:142668017-142668039 AGCTGAGCAGGCAGGCCCCTGGG + Intronic
998665022 5:144287353-144287375 AGCACAGCTGCCAGGCCCCTTGG + Intronic
998887096 5:146706134-146706156 TGCACAGCAGCCTCCCTCCTAGG + Intronic
999446714 5:151646238-151646260 AGCACTAGAGGCAGCCCCCTGGG + Intergenic
1001310505 5:170606900-170606922 TTCCCACCAGGCAGCGCCCTAGG + Intronic
1003240885 6:4344715-4344737 TGCACACCAGGCACCAGCCTCGG - Intergenic
1005987523 6:30884108-30884130 GGGACTGCAGCCAGCCCCCTGGG + Intronic
1006089083 6:31617168-31617190 TACACAGCTGGAATCCCCCTTGG - Intergenic
1007260770 6:40561538-40561560 TCCACAGCAGCCAGCCCCTGTGG - Intronic
1011569758 6:88722908-88722930 TGTACAGCTGGCAGCCCAGTAGG - Intronic
1015584163 6:134758628-134758650 TGCACATTAGGAAGCCCCTTTGG - Intergenic
1017880825 6:158561073-158561095 TGCACTGAAGGCAGCCTCCGAGG + Intronic
1018692882 6:166363236-166363258 TGCACTGCAGGCTTCCACCTGGG + Intergenic
1018929414 6:168230772-168230794 TGGACAGCAGGCTGGCCTCTGGG - Intergenic
1019559429 7:1648570-1648592 TCCACAGCAGGCTGCACCCCCGG + Intergenic
1022161514 7:27715529-27715551 TGCCCCACAGGCAGCCCTCTTGG + Intergenic
1022414920 7:30169549-30169571 AGCACACGAGTCAGCCCCCTAGG - Intergenic
1023806238 7:43875019-43875041 TCCACAGCAGGCAGCCTGCCAGG + Intronic
1024319378 7:48049913-48049935 AGCAAAGCAGGCACCCCACTTGG + Exonic
1025231959 7:57208388-57208410 CTCTCAGCAGGCAACCCCCTAGG - Intergenic
1026157954 7:67843742-67843764 CCCACAGCAGGGAGGCCCCTAGG - Intergenic
1029030949 7:97466122-97466144 AGCTCGGCAGGCAGCACCCTGGG - Intergenic
1029380466 7:100211110-100211132 TGAAGAGCAGGCAGCCCCTGTGG + Exonic
1030983152 7:116210372-116210394 TGCCCAGCAGGGCGCCGCCTCGG + Intergenic
1032020337 7:128404270-128404292 TGCCCTGCACTCAGCCCCCTGGG - Intronic
1032265421 7:130366891-130366913 AGCCCTGCAGGGAGCCCCCTCGG - Intronic
1034272374 7:149809437-149809459 TGCACAAGAGGCAGGGCCCTGGG - Intergenic
1034550740 7:151819082-151819104 GGCACAGGCTGCAGCCCCCTTGG + Intronic
1035166481 7:156993377-156993399 TGCACAGCCTGCAGCCGCCAGGG - Intergenic
1035192561 7:157184059-157184081 TGCGATGCAGGCAGCCCCGTCGG + Intronic
1035640914 8:1184642-1184664 TTTTCAGCAGGCAGCACCCTCGG + Intergenic
1037623477 8:20587635-20587657 TGCACACCAGGCCGTCTCCTGGG - Intergenic
1038573972 8:28688003-28688025 TTGACAGCAGCCAGCCCCCCAGG + Intronic
1040816657 8:51515131-51515153 TCCTCAGCAGGCATCCACCTGGG - Intronic
1042520234 8:69703697-69703719 TGCACTGGAGGCAGCCACCCTGG + Intronic
1044474635 8:92612057-92612079 TGTTAAGCAGCCAGCCCCCTGGG + Intergenic
1045063680 8:98427658-98427680 AGGTCAGCATGCAGCCCCCTGGG + Intronic
1046733364 8:117750066-117750088 TTCACATCAGTCTGCCCCCTTGG + Intergenic
1047067084 8:121296795-121296817 TCCACAGAAGCCAGCCTCCTTGG + Intergenic
1048543568 8:135365194-135365216 TGGAGAGCAAGCAGTCCCCTTGG + Intergenic
1048863879 8:138744727-138744749 TGCATAGCAGGCACTTCCCTAGG - Intronic
1049248157 8:141573868-141573890 AGCAGAGCCGGCAGCCCCCGGGG + Intergenic
1049770652 8:144379418-144379440 TGCACAGCAGGCAGAAGCCCTGG + Exonic
1052270264 9:26621073-26621095 GGCACAGCAGGCAAAACCCTGGG - Intergenic
1055324298 9:75112568-75112590 TGAACAGCAGGCAACTCCTTAGG - Intronic
1055525151 9:77125820-77125842 TACCCAGCAGGGAGCCTCCTGGG + Intergenic
1055570932 9:77616404-77616426 TGCACAGCAGTTAGCTTCCTTGG - Intronic
1055734574 9:79313228-79313250 TGCTCAGCAGGCAGCCCAGTGGG + Intergenic
1057128876 9:92639832-92639854 TGCCCAGCAGCCAGCGCCATGGG + Intronic
1057440836 9:95082096-95082118 AGCACAGCAGGCAGCAGCCGCGG - Intronic
1057452315 9:95175724-95175746 TGCACAGCAGGGAGAGCACTTGG + Intronic
1058578711 9:106431481-106431503 TGCACGGCAGACAGCTCTCTGGG - Intergenic
1059338009 9:113581077-113581099 TGCCCTGCAGCCAGCTCCCTGGG - Intronic
1059723350 9:116983095-116983117 TGAACAGCAGGCAGCATCCCTGG - Intronic
1060530482 9:124344642-124344664 TGCAGAGCGGGCAGCCCGCTGGG - Intronic
1060701031 9:125748313-125748335 TGCCCGGCAGGCAGCAGCCTCGG - Intronic
1060818419 9:126647946-126647968 GGCACAGACGGCAGCTCCCTGGG - Intronic
1061406493 9:130395366-130395388 GGGACAGAAGGCAGCACCCTGGG - Intronic
1061573542 9:131492272-131492294 TACACAGCACGCAGTCCCCAGGG - Intronic
1061913873 9:133738945-133738967 TGCACAGCACGTAGCCCCCAGGG + Intronic
1062107449 9:134763714-134763736 GGCTCCCCAGGCAGCCCCCTGGG - Exonic
1062134143 9:134915804-134915826 TGAACAGCAGGCACCTGCCTTGG - Intronic
1062373650 9:136252509-136252531 TGCACAGCCGGCCGCCCACCCGG + Intergenic
1062403485 9:136382614-136382636 TGCACAGCCAGCATCTCCCTAGG - Intronic
1062439787 9:136564530-136564552 GGCACAGCGGGCAGCACCCCAGG + Intergenic
1062715647 9:138008861-138008883 GGGACGGCAGGCAGCACCCTTGG - Intronic
1203457755 Un_GL000220v1:6853-6875 AGCAGAGCAGGCGGCTCCCTGGG + Intergenic
1197593661 X:128441082-128441104 TGCACAGCAGGCAGCTCGTGTGG + Intergenic