ID: 1103939627

View in Genome Browser
Species Human (GRCh38)
Location 12:124494766-124494788
Sequence GGATTGGGGTGGCTTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 302}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103939627_1103939643 9 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939643 12:124494798-124494820 CTGCGGCAGCGGGGGAGCAGAGG 0: 1
1: 0
2: 1
3: 30
4: 380
1103939627_1103939646 26 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939646 12:124494815-124494837 CAGAGGTGAGGCTAGGCTGCAGG 0: 1
1: 0
2: 0
3: 28
4: 348
1103939627_1103939634 -8 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939634 12:124494781-124494803 CCCAATCCTACCCAATACTGCGG 0: 1
1: 0
2: 1
3: 10
4: 96
1103939627_1103939638 -1 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939638 12:124494788-124494810 CTACCCAATACTGCGGCAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 51
1103939627_1103939640 1 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939640 12:124494790-124494812 ACCCAATACTGCGGCAGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1103939627_1103939637 -2 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939637 12:124494787-124494809 CCTACCCAATACTGCGGCAGCGG 0: 1
1: 0
2: 1
3: 4
4: 54
1103939627_1103939639 0 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939639 12:124494789-124494811 TACCCAATACTGCGGCAGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1103939627_1103939645 19 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939645 12:124494808-124494830 GGGGGAGCAGAGGTGAGGCTAGG 0: 1
1: 0
2: 10
3: 106
4: 832
1103939627_1103939644 14 Left 1103939627 12:124494766-124494788 CCCCCTGGAAGCCACCCCAATCC 0: 1
1: 0
2: 1
3: 26
4: 302
Right 1103939644 12:124494803-124494825 GCAGCGGGGGAGCAGAGGTGAGG 0: 1
1: 0
2: 5
3: 65
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103939627 Original CRISPR GGATTGGGGTGGCTTCCAGG GGG (reversed) Intronic
900292332 1:1928810-1928832 GGAGTGGGAGGGCTTCCTGGCGG + Exonic
900745926 1:4360741-4360763 GGACCGGTGTGGCTTGCAGGAGG - Intergenic
900929499 1:5727512-5727534 GGCTTGGGAAGACTTCCAGGAGG - Intergenic
901078273 1:6569157-6569179 GGATTGGGGTGGTTTAATGGAGG + Intronic
902409004 1:16202075-16202097 GGGTAGGGCTGGCATCCAGGGGG - Intronic
903271610 1:22191986-22192008 TGCTTGGGGTGGCTTTCAGCTGG + Intergenic
903713993 1:25349351-25349373 GGATTGTGGTGGCTCACAGAGGG + Intronic
903766713 1:25739940-25739962 GGATGGGGAGGGCTTCAAGGGGG - Intronic
904403007 1:30269228-30269250 AGATTTCGGTGGCTTCCTGGAGG + Intergenic
904770273 1:32877386-32877408 GTAGGGGGATGGCTTCCAGGAGG - Intergenic
905210033 1:36367629-36367651 AGATTGGTGTGTCTACCAGGTGG - Intronic
906586547 1:46983839-46983861 GGAGTGGGGTGGCTTCACTGGGG + Intergenic
906680182 1:47720975-47720997 GGGTTGGGGATGCTTCCTGGAGG + Intergenic
907221106 1:52907485-52907507 GGGTTGGGAAGGCTTCCTGGAGG + Intronic
908303287 1:62783959-62783981 GGCTTGGGGTGGCGAACAGGTGG + Intergenic
909539253 1:76772373-76772395 GGATTGATCTGACTTCCAGGAGG + Intergenic
913340862 1:117756999-117757021 GGTTTGGGGTGGATTTTAGGAGG + Intergenic
913685025 1:121223417-121223439 AGATTAGGCTGACTTCCAGGTGG - Intronic
914036870 1:144011021-144011043 AGATTAGGCTGACTTCCAGGTGG - Intergenic
914152584 1:145056910-145056932 AGATTAGGCTGACTTCCAGGTGG + Intronic
915014032 1:152716924-152716946 AGATTGGGGTGGCTGGTAGGTGG + Intergenic
915102043 1:153507672-153507694 GGGTGAGGGTTGCTTCCAGGAGG - Intergenic
915113884 1:153583111-153583133 GGACGGGGGTGGCTGCCGGGTGG - Intergenic
917199178 1:172497480-172497502 GAATTGGGGAGGCATCCAGGAGG - Intergenic
918122042 1:181548727-181548749 GGTTTGGGATGGTTTCCAGATGG + Intronic
920284043 1:204866918-204866940 GGGTTGGATTGGCTTCCTGGAGG + Intronic
920472343 1:206241974-206241996 AGATTAGGCTGACTTCCAGGTGG - Intronic
920747010 1:208638387-208638409 GGACTGGGTTGGAATCCAGGTGG - Intergenic
923140675 1:231159997-231160019 GGGTAGGGGTGGCCTCCTGGAGG - Intergenic
923197648 1:231683801-231683823 GGCCCAGGGTGGCTTCCAGGTGG - Intronic
1063572772 10:7231457-7231479 GAATAGCGGTGACTTCCAGGTGG - Intronic
1063975509 10:11412388-11412410 GCAATGGGGAGGCTTCCAGAGGG - Intergenic
1064368115 10:14726576-14726598 GGCTAGACGTGGCTTCCAGGGGG - Intronic
1065481245 10:26195873-26195895 GGATTGGTGTGGCTTCCACGAGG + Intronic
1065811939 10:29450610-29450632 GAATCAGGGTGGCTTCCGGGAGG - Intergenic
1065959841 10:30725547-30725569 GGATCAGGGTGGCTTCTGGGAGG + Intergenic
1067508414 10:46875870-46875892 AGGTTGGGGAGGCTTCCTGGAGG + Intergenic
1067653835 10:48175979-48176001 AGGTTGGGGAGGCTTCCTGGAGG - Intronic
1069709220 10:70478480-70478502 GGGTTTGGGTGTCTTCCAGAAGG + Intergenic
1069771562 10:70903682-70903704 GGATTGTGGGGGTTTCAAGGAGG + Intergenic
1069893584 10:71666796-71666818 GGGTTGGAGTGGCTGGCAGGAGG - Intronic
1069919547 10:71808119-71808141 GGATTGGTGTGGCTGGCTGGGGG - Intronic
1070135469 10:73689824-73689846 TGGATGGGGTGGCTGCCAGGCGG - Intronic
1070918712 10:80170912-80170934 GGCTTGGTGTTGCTTTCAGGTGG - Exonic
1071487542 10:86112623-86112645 TGATTGTGGTGTCTGCCAGGGGG + Intronic
1071509946 10:86255098-86255120 GGTGTGGGGTGACATCCAGGTGG - Intronic
1071720997 10:88145971-88145993 GGATTTGAGTGGAATCCAGGCGG + Intergenic
1071734509 10:88283148-88283170 CGTCTGGGATGGCTTCCAGGAGG + Intronic
1071820142 10:89271553-89271575 GGAGTATGGTGGCTTGCAGGAGG + Intronic
1072023948 10:91435161-91435183 TGATTGGGGTGGGTTCCCTGGGG - Intronic
1072544069 10:96420884-96420906 GGCTTGGGTTGGATTCCTGGAGG - Intronic
1073071762 10:100798791-100798813 GGAATGGGGTGGCTCCCCAGAGG - Intronic
1075071066 10:119320157-119320179 GGATTGGAGGGGCTGCCAGGTGG + Intronic
1075414089 10:122249673-122249695 GGAGGGGTGTGGCCTCCAGGTGG + Intronic
1076108248 10:127841678-127841700 GGAGTGGGGAAGCATCCAGGTGG - Intergenic
1077292149 11:1802579-1802601 GAAGTGGGGTGGCTTTTAGGAGG + Intergenic
1077540758 11:3145471-3145493 GGGCAGGGGTGGCTTCCAGAAGG - Intronic
1083408102 11:62472461-62472483 GGATTGGGGTGGTTTCTGGCAGG - Intronic
1083429006 11:62604094-62604116 GGGTTGGGGTGGCTCCCACCTGG + Exonic
1083445462 11:62705571-62705593 GGCCAGGGGTGGCGTCCAGGTGG - Exonic
1084770798 11:71341779-71341801 GGGATGGGGTGGCTCCTAGGTGG + Intergenic
1085405576 11:76259847-76259869 GGACAGGGAGGGCTTCCAGGAGG + Intergenic
1085527600 11:77173343-77173365 AGATGGGGGAGGCTTCCAGGAGG - Intronic
1086866589 11:91987022-91987044 GGATTGGGGTGGAGTGCAGTGGG - Intergenic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1087825735 11:102763042-102763064 AGATTAGGGAGGCTTCCAAGAGG - Intergenic
1089056800 11:115592191-115592213 GATTTGGGGTTGCTTTCAGGTGG + Intergenic
1089328355 11:117672970-117672992 GGTCTGGGGAGGCTTCCTGGAGG - Intronic
1089666064 11:120020352-120020374 GCATTGGGGTTGCTTCCAGCTGG - Intergenic
1091167576 11:133493148-133493170 GGATGGGGGTGGCCTTCTGGGGG - Intronic
1095095318 12:38144682-38144704 GGATGGGAGTGGATTTCAGGAGG - Intergenic
1096103360 12:48982415-48982437 GGATTGGGTTGGGTTGGAGGTGG - Intergenic
1096124405 12:49109203-49109225 GGATTAGGGAGACATCCAGGAGG + Intronic
1096392799 12:51242336-51242358 GCATTGGGAGGGCATCCAGGAGG - Exonic
1096501204 12:52064715-52064737 GGAAGGGGGTTGATTCCAGGAGG - Intergenic
1096559435 12:52424999-52425021 GGACTGGAGCTGCTTCCAGGAGG - Intronic
1097149134 12:56963723-56963745 CGGTCGGGGTGGCTGCCAGGCGG - Intergenic
1098030532 12:66249040-66249062 AGATTAGGGAAGCTTCCAGGAGG - Exonic
1099223826 12:79944790-79944812 GGAAAGAGATGGCTTCCAGGAGG + Intergenic
1100739296 12:97573386-97573408 GGCTTGGAAAGGCTTCCAGGTGG - Intergenic
1102040285 12:109796510-109796532 AGATTGAGGTGGGCTCCAGGAGG - Exonic
1102057135 12:109905149-109905171 GGGTTGGGGAGGCTTCCCAGAGG + Intronic
1102511856 12:113421342-113421364 GGGCTGGGGAGGCTTCCTGGAGG - Intronic
1103737433 12:123069597-123069619 GGCTTGGGAAGGCTTCCAGGGGG - Intronic
1103939627 12:124494766-124494788 GGATTGGGGTGGCTTCCAGGGGG - Intronic
1104256492 12:127143547-127143569 GGGTTGCGGTGGCTCTCAGGTGG + Intergenic
1104967131 12:132513405-132513427 GGATGGAGGTGTCTTCCGGGGGG + Intronic
1105774645 13:23646223-23646245 TGATTGGGGGGGCTTCAGGGTGG - Intronic
1107262486 13:38511458-38511480 GAATCTGGGTGGCTTCCATGAGG + Intergenic
1107553941 13:41501253-41501275 GCATATGGGTGGCTTCCATGTGG - Intergenic
1113139706 13:107133661-107133683 GGATAGGGATGGTTTCCAGGAGG - Intergenic
1114259476 14:21026302-21026324 GGATTGGGGGAGCTACAAGGGGG - Intronic
1118148618 14:63165713-63165735 CGGATGGGGTGGCTGCCAGGCGG - Intergenic
1118502328 14:66373426-66373448 GGTTTGGGTGGGCTTCCTGGAGG - Intergenic
1118635347 14:67743657-67743679 GCCTTGGGGTGAGTTCCAGGAGG + Intronic
1119263403 14:73251237-73251259 GGATGGGGAGGGCATCCAGGCGG - Intronic
1121199550 14:92106251-92106273 GGAGTGGGGTGGCGCCCAGTGGG - Intronic
1121498215 14:94412490-94412512 GGAATGGGATGGGTTGCAGGGGG - Intergenic
1121671133 14:95711603-95711625 GGATGGGAGAGGCTTCCTGGAGG - Intronic
1122075668 14:99233137-99233159 GGCTAGGGCAGGCTTCCAGGAGG - Intronic
1122632686 14:103114182-103114204 AGATTTGGGTGGCTCCCAGCAGG - Intergenic
1122732646 14:103812554-103812576 GGATTGGGGTGCCTGCCATCAGG + Intronic
1124619017 15:31263719-31263741 GGATTGCCCTGGCTTTCAGGGGG - Intergenic
1124925152 15:34063556-34063578 GGCTTGGGATGGCTTCCCAGTGG - Exonic
1126577315 15:50209825-50209847 GTTTTGGGGTGACTTCCAAGAGG - Intronic
1127147701 15:56041914-56041936 GGATTGGTGTAGCTGTCAGGTGG - Intergenic
1127899842 15:63333069-63333091 GGATGGGGAGGACTTCCAGGAGG + Intronic
1128634336 15:69293614-69293636 TAATTGGGGTGGCTTGGAGGAGG - Intergenic
1129709635 15:77813989-77814011 AGATTGGGGGGGCTTCCTAGGGG - Intronic
1130983346 15:88828123-88828145 GGCTGGGGGAGGTTTCCAGGCGG + Intronic
1131451208 15:92541668-92541690 GGGTTGGAGTGGGTCCCAGGAGG - Intergenic
1132468643 16:89650-89672 GCTTGGGGGTGGCATCCAGGAGG - Intronic
1132885465 16:2180279-2180301 GGAGTGGGGTGGCCCTCAGGAGG + Exonic
1134376599 16:13681444-13681466 GCATTGGAATGGATTCCAGGAGG - Intergenic
1135504132 16:23021653-23021675 GGATGGGGGTGGCCAACAGGGGG + Intergenic
1136409082 16:30066002-30066024 GGATGGGGGAGGCCTCCACGCGG - Intronic
1138526640 16:57612078-57612100 AGATTGGGGTGGGTCTCAGGAGG + Intronic
1138605355 16:58085083-58085105 AGTCTGGGGAGGCTTCCAGGAGG - Intergenic
1139378612 16:66516215-66516237 GGTCAGGGGTGGCTTCCTGGAGG + Intronic
1139653662 16:68374992-68375014 ACATTGGGGTGACGTCCAGGTGG - Intronic
1140046262 16:71442077-71442099 GGATTTCGGTGGCTGGCAGGGGG + Intergenic
1140474090 16:75229943-75229965 GGGTTGGGCTGGCGTCCAGTTGG + Exonic
1141878331 16:86841630-86841652 GAATGGGAGTAGCTTCCAGGGGG + Intergenic
1142132517 16:88437433-88437455 GCACCGGGGTGGCTTGCAGGAGG - Exonic
1142303647 16:89273868-89273890 GGGCTGGGGTGGCGTCAAGGGGG + Intronic
1142508491 17:380648-380670 GGATGAGGGGGGCTTCCGGGAGG - Intronic
1142508570 17:380866-380888 GGATGTGGGGGGCTTCCGGGAGG - Intronic
1142508670 17:381152-381174 GGATGTGGGGGGCTTCCGGGAGG - Intronic
1142508725 17:381288-381310 GGATGTGGGGGGCTTCCGGGAGG - Intronic
1142508743 17:381332-381354 GGATGTGGGGGGCTTCCGGGAGG - Intronic
1142599232 17:1045254-1045276 GAATTAGGGAGGCTTCAAGGAGG - Intronic
1142668088 17:1473824-1473846 GGGTTGGGGAGGCTCCCTGGAGG - Intronic
1142791800 17:2272410-2272432 GTATTGTGGTGGGTGCCAGGAGG - Intronic
1142970662 17:3609457-3609479 GCTGTGGGGTGGCTTCCAGGAGG - Exonic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1144656633 17:17041535-17041557 AAATTCGGGTGGCTTCAAGGAGG - Intergenic
1144826329 17:18107677-18107699 GGGTTGGGGGCCCTTCCAGGAGG + Exonic
1145015963 17:19398443-19398465 AAATTGGGCTGGCTGCCAGGTGG + Intergenic
1145939878 17:28737760-28737782 GGAATGGTGTGGCATCCATGGGG - Intronic
1146439191 17:32878494-32878516 GGATTGGGGTGGTTTTCTGATGG - Intergenic
1146447771 17:32946391-32946413 GGATTGGGGTGGATTTGGGGTGG - Intergenic
1146805042 17:35858295-35858317 GCATTTGGGTGGCTTCAAAGCGG + Exonic
1146943736 17:36860537-36860559 GGATAGGGGAGGCTTCCTGGAGG + Intergenic
1147961332 17:44169440-44169462 GAATGGGGGAGGCTGCCAGGTGG + Intergenic
1148406477 17:47420783-47420805 CGGATGGGGTGGCTGCCAGGCGG - Intronic
1149072974 17:52565043-52565065 GGAGTGGGGTGGCTGACAGGAGG + Intergenic
1151167467 17:72217808-72217830 GGATGGGTGTGGCTTCTAAGTGG - Intergenic
1151363741 17:73604139-73604161 GGCTAGGAGTGGTTTCCAGGTGG + Intronic
1151452963 17:74210567-74210589 GGGTTGGGGTGGCCACCAGGTGG + Exonic
1152106575 17:78332857-78332879 GGACTGGGGGGCCTTCGAGGAGG - Intergenic
1152572927 17:81128377-81128399 GGGCTGGGGTGGCTCCTAGGAGG + Intronic
1152612465 17:81322551-81322573 GGTGTGGGGCGGCTCCCAGGAGG - Intronic
1156452351 18:37274103-37274125 CAGTTGGGGTGGCTGCCAGGAGG - Intronic
1158427592 18:57353296-57353318 GGTTGGGGGAGGCTTTCAGGAGG + Intronic
1158696363 18:59707564-59707586 GCATGGGTGTGGCTTACAGGAGG + Intergenic
1159702846 18:71650863-71650885 GGATTTGGGTGCCTTCCCAGCGG - Intergenic
1160013355 18:75123270-75123292 GGCTTGGGGGAGCTTCCATGTGG + Intergenic
1160856191 19:1219021-1219043 TGCTTGGGGGGGCGTCCAGGAGG + Intronic
1160895505 19:1400242-1400264 GGGCTGGGGAGGCTTCCTGGAGG + Intronic
1161697670 19:5778629-5778651 GGAGTGCGGTGGCGTCCCGGGGG - Exonic
1161838966 19:6667233-6667255 GGGGTGGGGTTGATTCCAGGAGG - Intronic
1163534411 19:17868939-17868961 GGAGTGGGGTGGCTGCCGAGTGG - Intergenic
1164429462 19:28174603-28174625 GGGCTGGGCTGGCATCCAGGGGG + Intergenic
1165317440 19:35065461-35065483 GGAATGGGGTGGGCACCAGGAGG + Intronic
1165826851 19:38710453-38710475 AGCTGGGGGTGGCTTCCAGTTGG - Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166894563 19:46015642-46015664 GGCTTGGGGCGGCGTTCAGGAGG + Intronic
1167132159 19:47594038-47594060 GGTTTGGGAAGGCTTCCTGGAGG - Intergenic
1167156579 19:47742713-47742735 GCTGTGGGGAGGCTTCCAGGGGG - Exonic
1167504469 19:49863805-49863827 GGGCTGGGGTGGCATCCAGTAGG - Intronic
1167596431 19:50430783-50430805 GGAGTGGGGTGGATTTCAGGCGG - Exonic
1168346683 19:55653234-55653256 GGGTTGCGGGGGCTTCCAAGGGG + Intergenic
925343852 2:3155719-3155741 GGCTTGGGGGGGCTGCCAGTGGG + Intergenic
925586273 2:5467758-5467780 GGAGGAGAGTGGCTTCCAGGAGG - Intergenic
926219484 2:10925409-10925431 GGATTTGGGGAGCTCCCAGGTGG + Intergenic
926219507 2:10925476-10925498 GGATTTGGGGAGCTCCCAGGTGG + Intergenic
926219515 2:10925498-10925520 GGATTTGGGGAGCTCCCAGGTGG + Intergenic
926219532 2:10925543-10925565 GGATTTGGGGAGCTCCCAGGTGG + Intergenic
926727208 2:16007854-16007876 GGGTTGGGGTGGGTGGCAGGGGG + Intergenic
927891755 2:26755157-26755179 GGACTGGGGTGGATTCCGGCTGG - Intergenic
929290446 2:40184720-40184742 GGATTGTGATGGCTTACATGTGG - Intronic
929572947 2:43034070-43034092 AGATAGGGGAGGCTTCCTGGAGG - Intergenic
930002796 2:46872306-46872328 GGATGAGTGTTGCTTCCAGGTGG + Intergenic
930732716 2:54743973-54743995 GCATTTGGGTGGCCTCTAGGAGG + Intronic
932105139 2:68935399-68935421 GGTCTGGGGTGGCCTCAAGGTGG + Intergenic
932445213 2:71776584-71776606 TGCTTGGGGAGGCTTGCAGGAGG + Intergenic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
933890267 2:86762183-86762205 TGATTGGTGTGTCTTCCTGGTGG + Intronic
934852581 2:97710862-97710884 GGATTGGGAAGCCTTCCTGGAGG + Intergenic
935632015 2:105219836-105219858 GGATTGTGGTGGATGTCAGGAGG + Intergenic
935782659 2:106521657-106521679 GGAAAGAGGTGGTTTCCAGGAGG + Intergenic
936559302 2:113522965-113522987 GGTTTGGGATGGCTTCCTGAGGG + Intergenic
937273577 2:120670605-120670627 GGATTGGGGTGGCTTCTTCCTGG - Intergenic
938302687 2:130228259-130228281 GGCTTAGGGGGGCTTCCCGGAGG - Intergenic
938302722 2:130228361-130228383 GGCCTGGGGGGGCTTCCTGGAGG - Intergenic
938342766 2:130546521-130546543 GGGTCTGGGTGCCTTCCAGGTGG - Intronic
938347067 2:130574201-130574223 GGGTCTGGGTGCCTTCCAGGTGG + Intronic
938453947 2:131445861-131445883 GGCCTGGGGGGGCTTCCTGGAGG + Intergenic
939377254 2:141384719-141384741 GGATGGGAGTGGGTTTCAGGAGG - Intronic
939529903 2:143345459-143345481 GGGTTGGGGTGGGGTTCAGGTGG - Intronic
940241749 2:151570532-151570554 GGATGGGGATGGCATCCAGCCGG + Exonic
940812048 2:158255501-158255523 GGATGTGGATGGCTTCCATGTGG + Intronic
946665348 2:222043983-222044005 GGATTGGGGTGGATCCAGGGAGG + Intergenic
947617668 2:231568802-231568824 GGAGTGGGGTGCCAGCCAGGCGG - Intergenic
948455505 2:238102719-238102741 GGACTGGAGGAGCTTCCAGGTGG - Intronic
948778023 2:240299887-240299909 GGATGTGGGTGGCTTCCAGCTGG + Intergenic
949041469 2:241851795-241851817 GGATTGAGGTTGCTGCCTGGGGG + Intronic
1171326062 20:24294309-24294331 GGATTGGGGTGGAAAGCAGGAGG - Intergenic
1172183217 20:33016187-33016209 GGTGTGGGGTGGCATGCAGGAGG - Intronic
1173560525 20:44002154-44002176 GGGTTGGGAAGGCTTCCTGGAGG - Intronic
1173739920 20:45392829-45392851 GGATTGGGGTGGTTTGAGGGGGG + Intronic
1174083725 20:47989770-47989792 GGAGAGGGGAGCCTTCCAGGAGG - Intergenic
1175608724 20:60332546-60332568 GGGTTTGGGGAGCTTCCAGGAGG - Intergenic
1178013023 21:28308363-28308385 GGATAGGTGTGGTTTCCAAGTGG + Intergenic
1178486220 21:33021360-33021382 CGAAGGGGGTGGCTTCCAGTGGG + Intergenic
1178935782 21:36860342-36860364 GGAGGGGTGTGGCTTCCTGGAGG - Intronic
1181055505 22:20258841-20258863 TGGTTGGGGTGGCTTCCCGGAGG + Intronic
1181108744 22:20589532-20589554 GGCTTGGGGTGCCTGCCATGAGG + Intergenic
1182299827 22:29331215-29331237 GGAGTGGGGTGAGTTCCATGTGG + Intronic
1183204022 22:36406039-36406061 GGTTTAAGGTGGCTCCCAGGGGG + Intergenic
1183383771 22:37503488-37503510 GATCAGGGGTGGCTTCCAGGAGG - Intronic
1183543249 22:38441823-38441845 GCATTTGGGCCGCTTCCAGGCGG - Intronic
1183739883 22:39663598-39663620 GGATAGGGGTTGCTTCCTCGAGG + Intronic
1183910257 22:41073853-41073875 GAAGTGGGGTGGCTTTTAGGAGG + Intergenic
1184087320 22:42272661-42272683 GGACTGGGGAAGTTTCCAGGTGG - Intronic
1184383643 22:44161917-44161939 GGGTTGGGGTGTCTGCCATGTGG + Intronic
1184658839 22:45955989-45956011 GGAGTGGGGCTGCCTCCAGGAGG + Intronic
1184686039 22:46096771-46096793 GGCCTGGGGAGGGTTCCAGGGGG + Intronic
1185101315 22:48842408-48842430 GCATGGGGGTGGCTTCCAACGGG + Intronic
950441101 3:13010968-13010990 AGTGTGGGGAGGCTTCCAGGAGG - Intronic
950589545 3:13926664-13926686 GGGTGGGGATGGCTTCCAGGAGG + Intergenic
950606926 3:14090028-14090050 GGGTGGGGATGGCTTCCAGGAGG - Intergenic
953621236 3:44534701-44534723 GGGTGGGAGTGGCTTTCAGGAGG - Intergenic
953766920 3:45750105-45750127 GGAGTCAGGTGGCTTCCTGGAGG + Intergenic
954108762 3:48422863-48422885 GAATTGGTGTGGCTTCCAGCGGG + Exonic
954807736 3:53230155-53230177 TGAATGGGGTCTCTTCCAGGTGG - Intronic
954924249 3:54218259-54218281 GGATAAGGGTGGCGTGCAGGTGG + Intronic
955579628 3:60405087-60405109 GGATAGGGGTAGGTACCAGGTGG + Intronic
960968901 3:123125118-123125140 GGCCTGGGGAGGCTTCCAGAAGG - Intronic
961475017 3:127140855-127140877 GGGTTGGGGTGGGTGGCAGGTGG + Intergenic
962314656 3:134351518-134351540 GGAGAGGGGAGGCTGCCAGGAGG + Intergenic
962748853 3:138418082-138418104 GGTTTGGGGTGGCTTTCAGCAGG - Intergenic
963371860 3:144411671-144411693 GCATTGGCTTTGCTTCCAGGTGG + Intergenic
963606007 3:147412064-147412086 GGAGTGGGGTGGGTTGGAGGAGG + Intronic
967645833 3:191922518-191922540 GGATGGGGTGGGCTCCCAGGTGG + Intergenic
968571005 4:1340631-1340653 GGAATGTGGTGGGTTCCAGCTGG - Intergenic
969350628 4:6596176-6596198 GGGTGGGCGTGGCGTCCAGGTGG + Intronic
969694960 4:8729256-8729278 GGAGTGGGGGGCCTTGCAGGGGG + Intergenic
970413884 4:15837469-15837491 GGGTTGGGGAGGCCTCCTGGAGG + Intronic
981025422 4:140072759-140072781 GGATTTGGGTGTCTGTCAGGGGG + Intronic
985606070 5:858660-858682 AGGGTGGGGTGGCTTCCAGAGGG - Intronic
987366558 5:17153791-17153813 GGCTGGGGGTTGCTTCTAGGGGG + Intronic
988956388 5:36324220-36324242 GGACTGAGGTGGTATCCAGGAGG + Intergenic
993456312 5:88131256-88131278 GCCTTGGGATGGCTTCCATGTGG - Intergenic
997165712 5:131658716-131658738 GAAATGGGGTGGCTTTCAGGGGG + Intronic
997662787 5:135602369-135602391 GGATGGACCTGGCTTCCAGGAGG + Intergenic
998296183 5:140971105-140971127 GGATTGGGGTGGGCTACAGGTGG + Intronic
999236985 5:150104416-150104438 GGAACAGGGAGGCTTCCAGGAGG - Intronic
1001745197 5:174087179-174087201 GGTTTTGGGGGGCTTCCATGGGG + Intronic
1003122640 6:3330340-3330362 GGACTGTGGTGGTCTCCAGGTGG - Intronic
1003461737 6:6334984-6335006 CTCTTGGGGTGGCTCCCAGGAGG + Intergenic
1006377464 6:33679594-33679616 GGATTAGCGAGGCTTCCTGGAGG + Intronic
1006456862 6:34136941-34136963 GGGTTGGGGTGGGGGCCAGGCGG + Intronic
1006921304 6:37629271-37629293 GGTTTGGGGTGACTTCAAGGAGG + Intergenic
1007064324 6:38974586-38974608 CCATTGGAGAGGCTTCCAGGAGG + Intronic
1007139311 6:39555213-39555235 GGCTTGGGGAGGGCTCCAGGAGG - Intronic
1007581787 6:42964209-42964231 GGAGGGAGGTGGCCTCCAGGTGG + Exonic
1008451825 6:51660795-51660817 GGATTGGGAGAGCTTTCAGGTGG - Intronic
1008640572 6:53458357-53458379 GGATGGAGGAGGCATCCAGGAGG - Intergenic
1008853385 6:56052009-56052031 TAATTGGATTGGCTTCCAGGTGG - Intergenic
1008917348 6:56802794-56802816 TGGTTTGGCTGGCTTCCAGGTGG - Intronic
1009324911 6:62338243-62338265 GGTTTGGGGTGGTTGCCCGGGGG - Intergenic
1011297248 6:85838745-85838767 CAAATGGGGTGGCTGCCAGGCGG - Intergenic
1011526893 6:88275576-88275598 GAAGTGGGGTGGCTTTTAGGAGG + Intergenic
1013034019 6:106362461-106362483 GGATCAGGGAGGCTTCCTGGAGG + Intergenic
1015662324 6:135589330-135589352 GCCTTGGGGTGGCTCCCATGTGG - Intergenic
1017608043 6:156154119-156154141 AGATGGGGGAGGCCTCCAGGAGG + Intergenic
1018689122 6:166329561-166329583 GGATTGCTGTGGCTTCCGGGCGG - Exonic
1019055011 6:169217665-169217687 GGTTTGGGGTTGCTGGCAGGAGG + Exonic
1019547292 7:1584645-1584667 GGACTGGGAAGGCTTCCTGGAGG - Intergenic
1022808105 7:33843285-33843307 GGATTGGGGTCTCTTGCATGTGG + Intergenic
1023273647 7:38494406-38494428 GAGCTGGGGTGGCTTCCATGAGG - Intronic
1023459777 7:40383693-40383715 AGTTTGGGGTGGCTTCCCGGAGG + Intronic
1024147875 7:46535683-46535705 GGACTGAGGTGGCTTTCAAGGGG - Intergenic
1024294473 7:47831501-47831523 GGGTTGGGGGTGTTTCCAGGTGG + Intronic
1024301294 7:47889650-47889672 GGTTTGGGAAGGCTTCCTGGAGG - Intronic
1024541597 7:50479583-50479605 GGCTTGGGGAGGCTCCCTGGGGG - Intronic
1029473432 7:100768688-100768710 GGATTCAGGTAACTTCCAGGCGG - Exonic
1032334983 7:131016887-131016909 AGATTAGGGTGGTTGCCAGGGGG + Intergenic
1034264350 7:149773822-149773844 GGATCGGGGTGGAATCCGGGTGG - Intergenic
1037858438 8:22388218-22388240 GGATTGGGGTGGATCTGAGGTGG + Intronic
1038381977 8:27104567-27104589 TGATTGGGATGGTTCCCAGGGGG + Intergenic
1038478253 8:27884084-27884106 GGGTTGGGGTCGCTTCCTGGTGG - Intronic
1042150980 8:65783572-65783594 GGAAGGGGATGGCTTCTAGGTGG - Intronic
1043296123 8:78665944-78665966 GGACAGGGGTGGCAGCCAGGAGG + Intergenic
1044539146 8:93390566-93390588 GGATTGCGGAGGACTCCAGGTGG - Intergenic
1045486403 8:102634890-102634912 GTAATGGGGTGGCTCTCAGGAGG + Intergenic
1046501668 8:115085723-115085745 GGATTGGAGAGACTGCCAGGGGG - Intergenic
1047775562 8:128067581-128067603 GGAAAGGGGAGGCTTCCTGGGGG + Intergenic
1049239164 8:141528186-141528208 GATCTGGGGAGGCTTCCAGGAGG - Intergenic
1049781871 8:144432781-144432803 GGAATTGGGTGTCATCCAGGGGG - Intronic
1049893553 9:93232-93254 GGTTTGGGATGGCTTCCTGAGGG - Intergenic
1051659013 9:19408849-19408871 CGGTGGGCGTGGCTTCCAGGGGG + Intergenic
1053004100 9:34593082-34593104 GGGTTGGGGCGGGCTCCAGGAGG + Intergenic
1053350547 9:37410900-37410922 GGAATGAGGAGGCTTCCAGATGG - Intergenic
1053420735 9:37975909-37975931 GGAGAGGGGTGGCTTCCTGGTGG + Intronic
1053734772 9:41093300-41093322 GGTTTGGGATGGCTTCCTGAGGG - Intergenic
1054359747 9:64101221-64101243 CGGATGGGGTGGCTGCCAGGCGG - Intergenic
1054693610 9:68338097-68338119 GGTTTGGGATGGCTTCCTGAGGG + Intronic
1055957874 9:81791399-81791421 GGATGTGGGTGGCTTCTAGAGGG + Intergenic
1056546238 9:87616226-87616248 GGAGTGGGATGGCTTCATGGGGG + Intronic
1056926313 9:90837718-90837740 AGATGGCGGTGGCTTCCACGAGG + Intronic
1057184702 9:93050562-93050584 AGAATGAGGTGGTTTCCAGGAGG + Intergenic
1057194900 9:93111478-93111500 GGCGTGGGGAGGCCTCCAGGGGG - Intronic
1058084360 9:100732651-100732673 GAAGTGGGGTGGCTTTTAGGAGG - Intergenic
1060098171 9:120812625-120812647 GGATGTAGATGGCTTCCAGGTGG - Intergenic
1061800000 9:133108643-133108665 GGACTGGGGTGGGTGCCAGAGGG - Intronic
1061806577 9:133140548-133140570 GGACTGGGGTGCCCTCCAGCAGG + Intronic
1061896952 9:133653183-133653205 GGCCTGGGGTGGCACCCAGGAGG - Intronic
1062115132 9:134804629-134804651 AGATGAGCGTGGCTTCCAGGTGG + Intronic
1062211360 9:135366029-135366051 GGCTTGGGAAGGCTTCCTGGAGG - Intergenic
1062612255 9:137380462-137380484 GGATTGGGGGGGATGCCCGGAGG - Intronic
1186400688 X:9256716-9256738 AGATTGGGGTTGCTTCCTGAAGG - Intergenic
1189152473 X:38722596-38722618 AAATTGGTGTGTCTTCCAGGAGG + Intergenic
1189221754 X:39378064-39378086 GGGTTGGGGGAGCTTCCAGAGGG + Intergenic
1189650578 X:43184707-43184729 GTGTTGGAGTGGCTTCAAGGAGG - Intergenic
1189812564 X:44794279-44794301 GAAGTGGGGTGGCTTTTAGGAGG - Intergenic
1189888945 X:45578287-45578309 GGATTGAGGAGGCTTCAAGATGG - Intergenic
1192234285 X:69286021-69286043 GGATTAGGGAGGCTTCCAAGAGG + Intergenic
1195697557 X:107678107-107678129 GGACTGAGGGGGCTGCCAGGAGG + Intergenic