ID: 1103940368

View in Genome Browser
Species Human (GRCh38)
Location 12:124498259-124498281
Sequence CACCATGGTAAGCGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103940368_1103940374 3 Left 1103940368 12:124498259-124498281 CCTGGCACACGCTTACCATGGTG 0: 1
1: 1
2: 1
3: 6
4: 65
Right 1103940374 12:124498285-124498307 ACGGGCACCAGAGACCAGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 281
1103940368_1103940372 -1 Left 1103940368 12:124498259-124498281 CCTGGCACACGCTTACCATGGTG 0: 1
1: 1
2: 1
3: 6
4: 65
Right 1103940372 12:124498281-124498303 GCACACGGGCACCAGAGACCAGG 0: 1
1: 0
2: 1
3: 18
4: 134
1103940368_1103940373 0 Left 1103940368 12:124498259-124498281 CCTGGCACACGCTTACCATGGTG 0: 1
1: 1
2: 1
3: 6
4: 65
Right 1103940373 12:124498282-124498304 CACACGGGCACCAGAGACCAGGG 0: 1
1: 0
2: 3
3: 20
4: 150
1103940368_1103940375 4 Left 1103940368 12:124498259-124498281 CCTGGCACACGCTTACCATGGTG 0: 1
1: 1
2: 1
3: 6
4: 65
Right 1103940375 12:124498286-124498308 CGGGCACCAGAGACCAGGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103940368 Original CRISPR CACCATGGTAAGCGTGTGCC AGG (reversed) Intronic
901613152 1:10515490-10515512 CACCCTGGAAAGAGAGTGCCTGG + Intronic
903834050 1:26191229-26191251 CACCATAGGAAGCCTCTGCCTGG - Intronic
904939348 1:34154298-34154320 CACCATGGAAATGGTGTGCCAGG - Intronic
907641436 1:56194162-56194184 CACCCTGGTTAGAGTATGCCCGG - Intergenic
916681359 1:167108140-167108162 GACCATGGTAAGGCTGGGCCAGG - Intronic
917680471 1:177361003-177361025 CATGGTGGTAAGGGTGTGCCCGG + Intergenic
922776313 1:228215725-228215747 CCGGATGGTGAGCGTGTGCCGGG - Exonic
1065770920 10:29077766-29077788 CAGCATGGTTTGCTTGTGCCTGG - Intergenic
1067098256 10:43316352-43316374 CACCAGGGGAAGCCTGGGCCTGG + Intergenic
1075333670 10:121593757-121593779 CACCATGGCAACCTTGTCCCTGG - Exonic
1076123027 10:127951374-127951396 TACCATGGTAACTGTGTGCTGGG + Intronic
1076235425 10:128860660-128860682 CAGCATGGGAAGCATCTGCCCGG + Intergenic
1085906808 11:80774196-80774218 CACCATGGTGATCCTGGGCCTGG - Intergenic
1091420807 12:338468-338490 TACCCTGGGAAGCCTGTGCCTGG + Intronic
1092801436 12:12171825-12171847 CACTATGGTTAACTTGTGCCCGG - Intronic
1093371951 12:18376246-18376268 CACCATTGTATCCGTGTGCTTGG + Intronic
1103940368 12:124498259-124498281 CACCATGGTAAGCGTGTGCCAGG - Intronic
1119193581 14:72701259-72701281 CACCTTGGCAAGCGTGCACCTGG + Intronic
1120444696 14:84579423-84579445 CTCCATGTTAAGCCTGTGGCTGG - Intergenic
1121255749 14:92528985-92529007 GCCCATGGTAAGCTGGTGCCTGG + Intronic
1121522543 14:94596151-94596173 CACAATGATAAGAGTGAGCCTGG + Intronic
1123553148 15:21400945-21400967 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1123589394 15:21838333-21838355 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1202961497 15_KI270727v1_random:128165-128187 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1135051689 16:19198331-19198353 CACCACTGTAAACATGTGCCAGG - Intronic
1136088852 16:27904000-27904022 CCCCAAGGCAAGAGTGTGCCTGG - Intronic
1142619104 17:1153845-1153867 CACCATGTGATGCGTGTGACAGG - Intronic
1144771354 17:17761415-17761437 CACCATGGTGCCCCTGTGCCTGG - Intronic
1144945914 17:18969372-18969394 CACCATGATGAGCGTCTGCAGGG - Exonic
1151920195 17:77148773-77148795 CACAATGGAAAGTGTGTGGCAGG - Intronic
1160733849 19:652990-653012 CACCCTGGCCTGCGTGTGCCTGG - Intronic
1161739235 19:6010257-6010279 CATGATGGTATGCGTGTTCCTGG - Intronic
1162039099 19:7958466-7958488 CTCCGAGGTAAGCCTGTGCCAGG - Intergenic
1164534616 19:29075981-29076003 CTCCGTGGCAAGCTTGTGCCTGG + Intergenic
1166255583 19:41601946-41601968 GACCCTGGGAAGCCTGTGCCGGG + Intronic
1166525790 19:43508772-43508794 CACCATGGTAATCGTGAGCAGGG + Exonic
932180376 2:69641695-69641717 CACCATGGTAAGCATTTCCCAGG + Intronic
947574377 2:231260981-231261003 GACCATGGCCAGGGTGTGCCTGG - Intronic
947697713 2:232206063-232206085 CACCATGGGAGGCCTGTGCAGGG + Intronic
948301928 2:236914075-236914097 CACCTGGGTGAGCCTGTGCCTGG - Intergenic
1175141954 20:56867313-56867335 CACCATGGTGAGTGTGTGCAGGG - Intergenic
1176820332 21:13650234-13650256 CACCTCTGCAAGCGTGTGCCAGG - Intergenic
1183057507 22:35315891-35315913 CACCATGGTATCCCAGTGCCTGG + Intronic
1183358491 22:37371682-37371704 CACCATGGTAACCCTGTGCCTGG - Exonic
950477430 3:13222961-13222983 CACCTTGGTAAGTGGATGCCAGG - Intergenic
954711674 3:52508020-52508042 CATCATGGTAAGCGTGGGCATGG + Exonic
966514707 3:180806003-180806025 CACCAGGGTTAGCATGGGCCAGG + Intronic
968602597 4:1517390-1517412 CACCATGGTGTGGGTGTGCCGGG - Intergenic
970721554 4:18995217-18995239 CCCCATGGCAAGTGTCTGCCTGG - Intergenic
971164803 4:24172010-24172032 CACAATGGTAAGATAGTGCCTGG - Intergenic
973395055 4:49586902-49586924 CACGTTTGTAAGGGTGTGCCTGG - Intergenic
977205546 4:94161377-94161399 TACAATGGTAAGCCTGTGACTGG + Intergenic
985698853 5:1358593-1358615 CACCCTGGCAAGTGTGTGCAAGG + Intergenic
999173909 5:149618300-149618322 CCCCAGGGTGAGCGTGCGCCTGG + Exonic
1000817927 5:165946654-165946676 TACCATAGAAAGAGTGTGCCTGG + Intergenic
1001698302 5:173688953-173688975 CACCATGGTCAGTGAGTGTCTGG - Intergenic
1002204244 5:177552192-177552214 CACCATTGTACCCCTGTGCCTGG - Intronic
1002377229 5:178797206-178797228 CACCATGGTAAGGGCTTCCCCGG - Intergenic
1003199225 6:3943563-3943585 CACCAAGGTCACCGTGTGCAGGG - Intergenic
1004395859 6:15245858-15245880 CACCAGGCTAAGCGGGCGCCTGG + Intergenic
1013071426 6:106732714-106732736 GTCCATGTTATGCGTGTGCCTGG - Intergenic
1016795181 6:148110164-148110186 CACCATGGTAAGCCTGTGCCGGG + Intergenic
1017146626 6:151240718-151240740 CACCAAGGTACGGGCGTGCCGGG + Exonic
1024526357 7:50353310-50353332 CATCATGGCAAGAGTGTGGCTGG - Intronic
1026829618 7:73602915-73602937 AACGATGGTAAGCGGGTGGCTGG - Intronic
1030969426 7:116036347-116036369 CAACTTGGGAAGCATGTGCCTGG - Intronic
1031878824 7:127173233-127173255 CAGCATGATAAACGAGTGCCAGG + Intronic
1032404330 7:131644765-131644787 CACCGTGGTGAGCTTGTTCCTGG + Intergenic
1043418314 8:80074338-80074360 CCCCATGTTAAGTCTGTGCCTGG + Intronic
1055091523 9:72368318-72368340 CACCAAGTTAAGTGAGTGCCTGG - Intergenic
1058475459 9:105328474-105328496 CCCCACGGTGAGAGTGTGCCAGG + Intronic
1203527028 Un_GL000213v1:99317-99339 CACCTCTGCAAGCGTGTGCCAGG + Intergenic
1198438375 X:136638685-136638707 CATCTTGGTAAGCGTGGACCTGG - Intergenic
1200229119 X:154435309-154435331 CTCCATGGTAAACCAGTGCCGGG - Exonic