ID: 1103941961

View in Genome Browser
Species Human (GRCh38)
Location 12:124506085-124506107
Sequence CCTGCTTTGCCTGGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103941961_1103941975 24 Left 1103941961 12:124506085-124506107 CCCTTCACCCCAGGCAAAGCAGG 0: 1
1: 0
2: 0
3: 29
4: 247
Right 1103941975 12:124506132-124506154 TTATCTCATGCTAACACCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 103
1103941961_1103941967 -5 Left 1103941961 12:124506085-124506107 CCCTTCACCCCAGGCAAAGCAGG 0: 1
1: 0
2: 0
3: 29
4: 247
Right 1103941967 12:124506103-124506125 GCAGGCCCCACCTCCACTCCAGG 0: 1
1: 2
2: 14
3: 286
4: 2147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103941961 Original CRISPR CCTGCTTTGCCTGGGGTGAA GGG (reversed) Intronic
900189083 1:1345756-1345778 CCTGCTCCGCCTTGGGAGAATGG - Intronic
900470440 1:2851611-2851633 CTTGGGTTGCCTGGGGTGGAGGG - Intergenic
900480201 1:2894500-2894522 GCTGCTTTGCCTGGTGGGGAGGG + Intergenic
900661835 1:3788544-3788566 CCTGCTTCGCCTGGAATGGATGG + Intronic
900771418 1:4547785-4547807 CCTGGATTGAATGGGGTGAATGG + Intergenic
902712504 1:18249956-18249978 CCTCCTTTCCCTGGGGAGAGAGG + Intronic
902830156 1:19007433-19007455 CCTGGTTTGCCTGGGACTAAAGG - Intergenic
903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG + Intronic
904350876 1:29905419-29905441 CATGCTGTGCCTGGGTTGCAGGG + Intergenic
904472533 1:30745113-30745135 CCTTCTTCCCCTGGGGTGATTGG - Intronic
904922438 1:34019614-34019636 CCTGCTTTGCCTCCTGTGACTGG + Intronic
905109828 1:35587253-35587275 CCTGCTTAGCCTCAGGGGAAGGG - Intronic
905434391 1:37946836-37946858 CCTGCTGGGGCGGGGGTGAAGGG - Intronic
905644002 1:39611843-39611865 CCTGCATTACCAAGGGTGAAGGG + Intergenic
908967100 1:69778528-69778550 CCTGCTTTGCTTGGGGATCAGGG + Intronic
909517967 1:76533612-76533634 CCTGTTCTGCCTGGAGGGAAAGG - Intronic
910823089 1:91372580-91372602 CCTGTTGTGGGTGGGGTGAATGG + Intronic
915118712 1:153615597-153615619 CCTGCTCTGCCTGCGGTGGGGGG - Intronic
915570092 1:156740670-156740692 CCTGGATTGACTGAGGTGAAGGG - Intronic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
919667071 1:200302398-200302420 CCTGCTCTGCCGGGGGTGCGGGG - Intergenic
920093653 1:203471927-203471949 CCTGGGTTGCCTGGGGTGAGTGG - Intergenic
921802640 1:219418815-219418837 CCTGGGTTGCCAGGGGTGAGAGG - Intergenic
924126198 1:240854658-240854680 CCTGCTTTGCTTTGGATAAAAGG - Intronic
924941408 1:248814601-248814623 CCTGCTGAGCCTGGGGGGAGAGG + Exonic
1063020486 10:2122197-2122219 CCTGCTAAGCCTGAGGAGAAAGG + Intergenic
1064450665 10:15439468-15439490 CCTGCATTTCCCGTGGTGAAGGG - Intergenic
1066660421 10:37734240-37734262 CCTGATTTCCCTGGTGTGAGAGG - Intergenic
1067551732 10:47241158-47241180 ACGGCTTTTCCTGGGGTAAAAGG + Intergenic
1067685037 10:48461613-48461635 CCTTCTTTGCCTGGGCTGCCAGG - Intronic
1068363546 10:56012833-56012855 GCTGCTTTGCCTTGGGTCATGGG - Intergenic
1070190110 10:74104521-74104543 CCTGCTGTGACTGGGGTCCATGG + Intronic
1071021058 10:81057191-81057213 CCTCCTTTGCCTAGGATGAAGGG + Intergenic
1073316527 10:102585026-102585048 GCTGCTGTGCCTGGGGTGGTGGG + Intronic
1073607507 10:104911159-104911181 CCCACTTGGCCTGGGGTGAGGGG - Intronic
1074080659 10:110165876-110165898 CCTGATTTGCCCGGGATGGAAGG - Intergenic
1076152748 10:128176474-128176496 CCTACTGTGGCTGGTGTGAAGGG + Intergenic
1076815054 10:132910447-132910469 CGTGCTTTGCCTGCAGTGACGGG + Intronic
1078044799 11:7903929-7903951 CCTGGTGTTCCTGGGGTGAGGGG + Intergenic
1078152695 11:8772827-8772849 CCTGCCTTTCCAGGGGTGAGTGG + Intronic
1078459620 11:11504217-11504239 CCTGCCTTTGCTGGGGTGTATGG - Intronic
1079312738 11:19380825-19380847 CCTGCTTTGCCTGGGATTTAGGG + Intronic
1079370238 11:19846328-19846350 CCTGTTGTACCTGGGGTGAAAGG + Intronic
1079800193 11:24859753-24859775 CCTCCTTTGGCTGGGGGAAAGGG - Intronic
1081265393 11:41014748-41014770 TCTGGTTTGCCTGGGATGGAGGG + Intronic
1082029654 11:47594934-47594956 CCTGCGTTCCCCGGGGTGAGGGG + Intergenic
1083109075 11:60387306-60387328 TCTGCTTTGCCTGGGGAGTAAGG - Intronic
1083233884 11:61339720-61339742 CCTGCTTTGCCTTGGTTCAGGGG + Intronic
1084208013 11:67607178-67607200 CCCGCCTGGCCTGGGGAGAAGGG - Intronic
1085066215 11:73498323-73498345 CCTCCCTTGGCTGGGGGGAAGGG - Intronic
1085338178 11:75713424-75713446 CCTACTTTGCCCTAGGTGAAGGG + Intergenic
1086155501 11:83661111-83661133 CCTGCTTTGCCCGAGGTTAGTGG + Intronic
1087641632 11:100761030-100761052 CCTGCTTTGCCTGGGCTTCCTGG - Intronic
1090113741 11:123943742-123943764 CCTGGTGTTCCTGGGGTTAATGG - Exonic
1090237955 11:125163585-125163607 CCTGCCTGGCCTGGGGTCAGAGG + Intergenic
1090395503 11:126415598-126415620 GCTGCTTTGCCAGGGGAGAGGGG + Intronic
1091278391 11:134367954-134367976 CCGGCTTTCCCTGGGATGAGCGG + Intronic
1091933332 12:4414903-4414925 CCGGCCTTGCCTTGGGTGCAGGG + Intergenic
1092125972 12:6075290-6075312 CCTGCCCTGCCGGGGATGAACGG - Intronic
1093065697 12:14656033-14656055 CCTGCATTGACTGTGGTAAATGG + Intronic
1093770008 12:23007207-23007229 CCAGCTTTGCCTGGGTTGACAGG + Intergenic
1094499001 12:31006698-31006720 CCTGCTGTGCATGTGTTGAATGG - Intergenic
1095174614 12:39077389-39077411 CCTGCTTTGTCTGGGAGGACAGG - Intergenic
1096234139 12:49914316-49914338 ACAGCTTTGGCTGGGGAGAAAGG - Intergenic
1097119400 12:56719881-56719903 CCTGCTTGGGCTGGAGAGAAAGG + Exonic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1100898068 12:99206972-99206994 CTTTCTTTGTCTAGGGTGAATGG + Intronic
1103166594 12:118775054-118775076 CCTGCCTCCCCTGGGGTGACTGG + Intergenic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1104768327 12:131345056-131345078 CCTCCTGTGCCTGGGCTGAGAGG - Intergenic
1104856001 12:131902803-131902825 GCTGCTCTGCCTGGGGTGGCCGG + Intronic
1108345797 13:49545973-49545995 TCTGCATTGCATGGGGTGGAGGG - Intronic
1109961713 13:69639661-69639683 GCTGCATTGCCTGGGGTTGAAGG + Intergenic
1110657118 13:78013170-78013192 CCTGGTTTGCCTTGAGGGAAGGG + Intergenic
1111092110 13:83461734-83461756 CCTCCCTTGCCTGGGGAGAGGGG - Intergenic
1112282556 13:98075810-98075832 CCTGTATTGCCAGGAGTGAAAGG + Intergenic
1112409641 13:99151866-99151888 CTTTCTTTCCCTGGGCTGAACGG + Intergenic
1116241853 14:42353375-42353397 CCATTTTAGCCTGGGGTGAACGG - Intergenic
1117253057 14:53954235-53954257 TCTGCTTTGCATGGGGAGAGGGG - Intronic
1117579147 14:57134340-57134362 CTTGCTTTCCGTGGAGTGAAAGG + Intergenic
1118143699 14:63113206-63113228 TTTGCTTTGCCTGGGATGCAAGG - Intergenic
1119001690 14:70887875-70887897 TCTGCTTTGCTTGGGGAGAAAGG - Intergenic
1121883920 14:97525291-97525313 CCTGCATTGCCTGTGGTCATGGG - Intergenic
1123994714 15:25710414-25710436 CCTGCTGTGTCTGGGGTCAGTGG - Intronic
1126900993 15:53314066-53314088 CCTGCTTTGCCCAGGATGACAGG + Intergenic
1130108695 15:80948006-80948028 CCTCCTTTGGCTGGTTTGAAGGG - Intronic
1130198743 15:81805986-81806008 CCTGCACTGTCTGGAGTGAATGG - Intergenic
1130314196 15:82781365-82781387 TCTGCTGTGCCTGGGGTGAGGGG - Intronic
1130794886 15:87197402-87197424 CCTTCTTTTCCTGGGGTTCAGGG - Intergenic
1131992176 15:98103184-98103206 CCTGGTTTGCCTGGGATGGAGGG - Intergenic
1132214305 15:100051349-100051371 TCTGCTTTGCCTGGGGCCCAGGG - Intronic
1132514406 16:359556-359578 CCTGCTTTGCCTAGGGCTACAGG - Intergenic
1132545236 16:529977-529999 CCTGCTGTGCCAGGGGTCAGAGG - Intronic
1132659124 16:1053792-1053814 CTTGCTCTGCCTGGGGTCAGTGG - Intergenic
1134025185 16:10947659-10947681 CCTGGTTTGCCTGGGCTGAGGGG + Intronic
1134886863 16:17800852-17800874 CTTGCTTTTCCTGGGGAAAATGG + Intergenic
1135780328 16:25294290-25294312 CCTGCCTTCCCTGGCATGAATGG - Intergenic
1136506795 16:30709639-30709661 CCTGCTTTGCTGGAGGTTAATGG - Exonic
1136720267 16:32314378-32314400 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1136725318 16:32352771-32352793 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1136838643 16:33520654-33520676 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1136843649 16:33558828-33558850 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1138161321 16:54757554-54757576 CCTGGTTTGCCTGGGACTAAAGG - Intergenic
1139653124 16:68372475-68372497 CCTGCTTCCCCTGGTGTGAGTGG + Intronic
1141223989 16:82098062-82098084 CCTGCGATATCTGGGGTGAAAGG - Exonic
1141432655 16:83978693-83978715 TCTTCACTGCCTGGGGTGAATGG + Intronic
1142120985 16:88386563-88386585 CCTGCTGAGCCCGGGGAGAAGGG - Intergenic
1203001113 16_KI270728v1_random:164983-165005 CGTGCCAGGCCTGGGGTGAATGG + Intergenic
1203006164 16_KI270728v1_random:203391-203413 CGTGCCAGGCCTGGGGTGAATGG + Intergenic
1203132715 16_KI270728v1_random:1701387-1701409 CGTGCCAGGCCTGGGGTGAATGG + Intergenic
1203148808 16_KI270728v1_random:1820940-1820962 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1203153814 16_KI270728v1_random:1859126-1859148 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1143016177 17:3892434-3892456 CCTGCCTTGGCTGGGGCGAGAGG - Intronic
1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG + Intronic
1144659669 17:17059994-17060016 CCAGCTTTTCCTGGGGTGGGTGG + Intronic
1147241192 17:39091491-39091513 CCTGATCTGCCTGGGATGGAAGG - Intronic
1150130299 17:62665614-62665636 CCTGTCTTGCATGTGGTGAATGG + Intronic
1150284564 17:63947684-63947706 CCTCCTTTCCCTGAGGAGAAGGG + Intronic
1151578599 17:74964920-74964942 CCTGCTTTGCCAGGGGAGGATGG - Intronic
1151704239 17:75758298-75758320 CTTGCTGTGCCTGGGGTTTATGG - Exonic
1152567979 17:81108626-81108648 CCGGCTCTGACAGGGGTGAAGGG - Intronic
1152633018 17:81419228-81419250 CAGGCTCTGCCTGGGGTGAGAGG - Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153772105 18:8424641-8424663 CCTGCTGTGTCTGGGCTGCAAGG + Intergenic
1154031055 18:10754939-10754961 CCTCCTTGGGCTGGGGTAAAAGG + Intronic
1157443173 18:47725573-47725595 CCTGCTTTGGCTGCAGTGAAGGG - Intergenic
1157713646 18:49867133-49867155 CCTGGTTTGCATGGGGAGATGGG + Intronic
1158613014 18:58960356-58960378 CCATCTTTACATGGGGTGAAAGG + Intronic
1162461833 19:10818117-10818139 CCAGCCTTGCCTGGGATGACGGG + Intronic
1162539329 19:11284695-11284717 CCTGCTGCGCCTGGCGGGAAGGG - Intergenic
1162954073 19:14088916-14088938 GCTGGTTTGCCTGGGGGCAAAGG + Exonic
1163395779 19:17060141-17060163 CCTGCGTTTCCTGGCTTGAATGG - Intronic
1165308071 19:35014176-35014198 CCTCCTCTGCCTGTGGAGAAAGG - Exonic
1168636223 19:57999452-57999474 CCTGCTGTGCCTGCTGTGAAGGG - Intronic
927938969 2:27091984-27092006 GCAGCTCTGACTGGGGTGAAAGG + Intronic
929223379 2:39488204-39488226 CCTGTGTTGCCCAGGGTGAAGGG + Intergenic
931165715 2:59745292-59745314 CCTGCATAGCCTGTTGTGAAAGG - Intergenic
932055465 2:68438805-68438827 CCTGGTTTGCCTGGGACTAAAGG - Intergenic
932112512 2:69013671-69013693 CCCGCTTAGCCTGGGGTGGGGGG - Intronic
933773019 2:85755562-85755584 CCTGCTTCACCACGGGTGAAAGG - Intronic
935150223 2:100427284-100427306 CCTGCGCTGCCCGGGGTGGATGG - Intergenic
935810592 2:106793458-106793480 CCTACTCTGCTTGGGGAGAAAGG + Intergenic
941905504 2:170714384-170714406 CCTGGGTGGCCTGGGGAGAAGGG + Exonic
944464432 2:199985892-199985914 ACTGCCTTTGCTGGGGTGAAGGG - Intronic
944802852 2:203253336-203253358 CCGGCAGTGCCTGGGGTGACAGG + Intronic
947550369 2:231041338-231041360 CCTGCTTTTCCTGGGGTCCCTGG + Exonic
947702427 2:232245395-232245417 CCTGCTGTGCCTGGGGTTGTGGG + Intronic
949031656 2:241799971-241799993 CTTCCTTTTCCTGGTGTGAAGGG + Intronic
1170152976 20:13244834-13244856 TCTGCTTTGCCTGGTGTATATGG + Intronic
1171750624 20:29045030-29045052 CCTTATTTGACAGGGGTGAAAGG - Intergenic
1172093619 20:32450122-32450144 CCTGTCTTGCCTGGGGTGCTGGG - Intronic
1172232380 20:33345654-33345676 CTTACCTTGCCTGGGGTGGATGG - Intergenic
1173558143 20:43982588-43982610 CCTGGTATGCCTGGGGAGCAGGG + Intronic
1173967580 20:47124716-47124738 CCTGATTTGCCTGGGATTGAGGG - Intronic
1174302138 20:49590057-49590079 CCTCCTTTGGCTGGGGTGGTCGG - Intergenic
1174580004 20:51564557-51564579 CCTGGTTTGCCTGGGATTGAGGG + Intergenic
1174757852 20:53177207-53177229 CCTGCCTTACCAGGGGTAAAAGG + Intronic
1175302262 20:57951376-57951398 CCTGCTGTGCTTGGAGTGAGTGG + Intergenic
1176095082 20:63337772-63337794 CATGATTTGTCTGGGGTGAAGGG - Intergenic
1176257440 20:64159634-64159656 CCTGAGCTGCCTGGGGTGATGGG + Intronic
1177824145 21:26064009-26064031 CATGCTTTGCCTGGGGTTATTGG - Intronic
1178359565 21:31936948-31936970 CCCTCTTTGCCTGGGAAGAATGG - Intronic
1178641412 21:34347312-34347334 CCTGCTTTGCCTGGGACTAATGG + Intergenic
1179624352 21:42640067-42640089 CCTGATTAGACTGGGGTTAAGGG - Intergenic
1180910713 22:19447961-19447983 CCCGCCTGGCCCGGGGTGAATGG - Exonic
1180950086 22:19717024-19717046 CCCCCTTTCCCTGGGATGAAAGG + Intronic
1182115891 22:27756155-27756177 CAGGCTGTGCCTGGGGTGAAGGG + Intronic
1182211878 22:28683676-28683698 CGTGCCAGGCCTGGGGTGAATGG - Intergenic
1183346969 22:37313312-37313334 CCTGCTCTGCCGCGGGGGAAAGG - Intronic
1183588372 22:38766286-38766308 CCTGCTGTGCCTGGGTCGGAAGG - Intronic
1184143311 22:42592499-42592521 CCTGGTTTGGCTGGACTGAAGGG + Intronic
1184257080 22:43293428-43293450 CCAGCTTAGCCTGGGGCCAAAGG - Intronic
1184589182 22:45470160-45470182 GCTGCTTGGCCTGGAGGGAAAGG + Intergenic
949099015 3:120514-120536 CCTGCTTGGCCTTTGCTGAATGG + Intergenic
949120027 3:373819-373841 CCTCCCTTGGCTGGGGGGAAGGG + Intronic
949397902 3:3634717-3634739 CCTCCTGTGGCTGGGGTGCAAGG - Intergenic
950032545 3:9862362-9862384 CCTTCCTCACCTGGGGTGAAGGG - Intergenic
950053864 3:10010718-10010740 CCTTCCTCACCTGGGGTGAAGGG - Intronic
950335968 3:12193458-12193480 CCTTCTTTCCCTGGGGTCAGGGG - Intergenic
950635172 3:14309018-14309040 GCTGCTCTTCCTGGGGTGGAAGG - Intergenic
951698783 3:25473361-25473383 CTAGCATTGTCTGGGGTGAAGGG + Intronic
952316410 3:32236584-32236606 TCTGCTTTGCATGGTGTGATTGG - Intergenic
952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG + Intergenic
952891393 3:38044160-38044182 CCTGCTATTCCTGGGGTCAAGGG - Intronic
953531164 3:43740894-43740916 CCTGCATGGTCTGGAGTGAAAGG + Intergenic
953889569 3:46742307-46742329 CCTGCCTTGCCTCTGCTGAATGG - Intronic
955027398 3:55182980-55183002 CTTCCTTTGCGTGGGGTAAAAGG + Intergenic
956656539 3:71558293-71558315 CCAGCTTTCCCTGAGGTTAATGG - Intronic
956685580 3:71824604-71824626 CCTGCTCTGTCTTGGGTGAAGGG - Intergenic
957937705 3:86965769-86965791 ACTGTTCTGCCTGGGGTCAAGGG - Intronic
958938659 3:100286282-100286304 CCAGCTTTGCCTCTGGAGAATGG + Intronic
960407972 3:117285193-117285215 CCTTGTATGCCTTGGGTGAAGGG - Intergenic
961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG + Intergenic
962941673 3:140130239-140130261 CCTCCTTTGCCTTGTGGGAATGG + Intronic
963907507 3:150784905-150784927 CCTGTTTTGCCTTGACTGAAGGG + Intergenic
964157369 3:153602514-153602536 CCTACTTTGCTTGAGGTGAAGGG - Intergenic
965853932 3:173065647-173065669 GCTGCTTTGCCTGGGGTTGGAGG - Intronic
966258588 3:177948737-177948759 CCTGTTTGCCTTGGGGTGAAGGG - Intergenic
967035264 3:185644578-185644600 ACTGCTTTGCCTGGGGGGGGGGG + Exonic
967919755 3:194605788-194605810 CCTGCTTTGCCTCCAGTGAGGGG + Intronic
968582644 4:1402195-1402217 CCTGTTTTCCCCGGGGAGAAGGG - Intergenic
969050438 4:4369177-4369199 CGTGCTGTGCCTGGTTTGAAAGG + Intronic
969492639 4:7508932-7508954 GCTGCTTTCCCTGGGGACAAGGG + Intronic
972465497 4:39352143-39352165 CCAGCTATGCCTGGGATGATGGG - Intronic
976645467 4:87383092-87383114 CTTGCTTTCCCCAGGGTGAAAGG + Intronic
977416939 4:96744957-96744979 CCTGCTTAGCTTGTGGTTAATGG + Intergenic
977507519 4:97921199-97921221 CCTGCTTGGTCAGGGGTGCATGG - Intronic
978981235 4:114948375-114948397 CCTGCTTTGCCTGGTAGTAAAGG - Intronic
983190174 4:164746697-164746719 CCTGGTTTGCCTGGGACTAAGGG - Intergenic
986767035 5:10937635-10937657 TCTGCCCTGCCTGGGGAGAAGGG + Intergenic
989302163 5:39907523-39907545 ACAGCTTTGCCTGGCTTGAAAGG - Intergenic
991578910 5:68133831-68133853 CCTGTTATGTCTGGGATGAAGGG + Intergenic
991602845 5:68370707-68370729 CCTTCTTTACCTGGGGGGAGGGG + Intergenic
996638970 5:125730044-125730066 CCTCCTTTGGCTGGGGTGTGGGG - Intergenic
997042538 5:130275269-130275291 CCTGGTTTGCCTGGGGCTAAAGG + Intergenic
999200485 5:149812838-149812860 CCTGGATTGCCTGGGGGTAAGGG + Intronic
1000814758 5:165907217-165907239 ACTGGTGTGCCTGGGCTGAAAGG - Intergenic
1001330303 5:170757370-170757392 CCTTCTTTGACTGGACTGAAAGG - Intergenic
1001552166 5:172610984-172611006 CCTCCTGTGCTTGGGGAGAAAGG + Intergenic
1001922125 5:175609085-175609107 CCTGCTCTGTGTGGGGTGAACGG + Intergenic
1002108744 5:176893847-176893869 CCTGCTCTTCCTGGGGTGTCAGG - Intronic
1004256651 6:14070609-14070631 ACTGCATGGCCTTGGGTGAAAGG + Intergenic
1007074522 6:39058010-39058032 CCTGCCTTTCCTGGGGTGAGGGG + Intronic
1007076999 6:39074454-39074476 CATGTTTTCCCAGGGGTGAAGGG - Intronic
1016683970 6:146860786-146860808 GCTTCTGTCCCTGGGGTGAATGG + Intergenic
1016684370 6:146864761-146864783 CCTGCTTTGCCTATGAAGAAGGG + Intergenic
1017061654 6:150490599-150490621 CCTGGTTTGCCAGGACTGAAAGG + Intergenic
1018712970 6:166510136-166510158 CCTGCCCTGCCTGGGGAGGAAGG - Intronic
1019144835 6:169969929-169969951 ACTGGTTTTCCTGGGGTGGAAGG + Intergenic
1019256894 7:58120-58142 CCTGCTTTGCCTGCTTTGCAAGG + Intergenic
1019421576 7:953561-953583 CCTGGTGTGCCTGGGGTGGCGGG + Intronic
1019595733 7:1857550-1857572 CCTGCTGCGGCTGGGATGAACGG + Intronic
1022234078 7:28444530-28444552 CCTGCTGTGACTTGGTTGAAAGG - Intronic
1023122501 7:36924001-36924023 CCTCCTTGGCCTGGAGTGCAAGG - Intronic
1024025774 7:45408648-45408670 TCTCTTTTGTCTGGGGTGAAAGG + Intergenic
1027127844 7:75569699-75569721 CCTGATTTAACTGGGGTTAAGGG - Intronic
1027943960 7:84722568-84722590 CCTCCTTTGGCTGGGGGGAGGGG - Intergenic
1028569255 7:92268247-92268269 TATGCTTTGACTGTGGTGAAAGG + Intronic
1032457182 7:132082122-132082144 CCAGCTTTGCTTGGGATGATTGG - Intergenic
1032491041 7:132324726-132324748 CATCCTTTCCCTAGGGTGAATGG + Intronic
1032683307 7:134207663-134207685 CCTGGTTTGCCTCTGGGGAATGG + Intronic
1032851416 7:135798862-135798884 CCGGCTGTGACTGGGGTGAATGG - Intergenic
1035157403 7:156925493-156925515 CCTGCTCTGACTGGTGGGAAGGG + Intergenic
1036692977 8:10956404-10956426 CCTGCTTTGTATGGGGTGTTGGG - Intronic
1038934679 8:32235634-32235656 TCTGGTTTGCCTGGGGTTGAAGG + Intronic
1042938342 8:74082890-74082912 CTTCCTATACCTGGGGTGAAAGG - Intergenic
1045300094 8:100903492-100903514 CCTGCAGTGCCTGGGGAGGAGGG - Intergenic
1048388100 8:133932424-133932446 CCTGCTTAGACTAGGGTGATGGG + Intergenic
1048659003 8:136575129-136575151 CCTGCTTTGACAGGGATGCAAGG + Intergenic
1049210934 8:141386129-141386151 CCTGCATTGGTGGGGGTGAAAGG + Intergenic
1049536817 8:143186312-143186334 CCTCCTCTGCCAGGGCTGAAAGG + Intergenic
1049562923 8:143321055-143321077 CCTGCTGTGCCGGGGCTGATCGG - Intronic
1051867952 9:21702916-21702938 CTTGGTGTGCCTGGAGTGAAAGG - Intergenic
1052450551 9:28624925-28624947 GCTGCATTGCCTGGGGTTAAGGG + Intronic
1052750901 9:32489373-32489395 CTTGCTTTGCCTGCTATGAAAGG - Exonic
1055481368 9:76711893-76711915 CCTCCGTTACCTGGGGTGAAAGG - Intronic
1057359743 9:94362187-94362209 CCTGATTTGCCTGGGAGTAAGGG - Intergenic
1057607800 9:96513420-96513442 CATGCTTGGCCTGGGTTGGAAGG - Intronic
1057663600 9:97025902-97025924 CCTGATTTGCCTGGGAGTAAGGG + Intergenic
1059713314 9:116889395-116889417 ACTGCTGTGCCTGTGTTGAAGGG - Intronic
1060002660 9:119972670-119972692 TCTGCTTTGCCTGGGCTGGAAGG - Intergenic
1060334028 9:122704835-122704857 CTTGCATTGCCTGGAGGGAAAGG - Intergenic
1060483182 9:124029970-124029992 CATGCTTTCCCTGGGGTGGGGGG - Intronic
1060484254 9:124037158-124037180 CCTGCTCTTCCTTGGGTGACAGG + Intergenic
1061439766 9:130593166-130593188 GCTGCTTTAAATGGGGTGAATGG - Intronic
1061899626 9:133666259-133666281 CACCCTTTGCCTGGGGTGCAGGG - Intronic
1062297489 9:135840466-135840488 CCTGTTCTGCCTGGTGGGAAAGG - Intronic
1062538395 9:137030827-137030849 GCTTCTTTGCCTGGCGTGACAGG - Exonic
1185669425 X:1794557-1794579 CCTGCTCTCCCAGGGGTAAAGGG + Intergenic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1192406072 X:70887476-70887498 ACTCCTTTGCCTGGGGAAAAAGG + Intronic
1193565201 X:83067286-83067308 GCTGATTTGACTGGGATGAAGGG - Intergenic
1194058284 X:89164195-89164217 CCTCCTTTGGCTGGGGTGGTGGG + Intergenic
1195798244 X:108677586-108677608 CCTGGCTTGCCTGGTTTGAAAGG + Exonic
1196684449 X:118498095-118498117 TCTGCATTGCCTGGTGTAAACGG - Intronic
1198317763 X:135486805-135486827 CCTGCTGTGTGTGAGGTGAAAGG + Intergenic
1199041034 X:143115901-143115923 GCTCCTTTGCCTTCGGTGAAAGG - Intergenic