ID: 1103942543

View in Genome Browser
Species Human (GRCh38)
Location 12:124508884-124508906
Sequence GCTGATGGGGGGACAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 792
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 724}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103942530_1103942543 16 Left 1103942530 12:124508845-124508867 CCACAAGAGAGGTGAGGGAAGGC 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG 0: 1
1: 0
2: 3
3: 64
4: 724

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103942543 Original CRISPR GCTGATGGGGGGACAGGAGG TGG Intronic
900172235 1:1274581-1274603 CCTGGTGGGGGATCAGGAGGTGG + Intergenic
900345944 1:2210339-2210361 GGTGCTGGCGGGACAGGGGGTGG + Intronic
900353856 1:2250401-2250423 GCTGATGGAGGAGCAGGAAGTGG + Intronic
900394353 1:2447049-2447071 GCTGCTGGGAGCACATGAGGGGG - Intronic
900620532 1:3584946-3584968 GCTGAAGAGGGAACAGAAGGAGG + Intronic
900653327 1:3742093-3742115 GCTGCTGTGGGGACCTGAGGAGG + Intergenic
900709786 1:4106495-4106517 GCTGAAAGAGGGCCAGGAGGAGG + Intergenic
900783364 1:4632117-4632139 GCAGAGGGGGAGACAGAAGGAGG - Intergenic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
901156223 1:7141307-7141329 GGTGTTTGGGGGACAGGAGCAGG - Intronic
901516814 1:9753235-9753257 GCTGCTGATGTGACAGGAGGTGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901672832 1:10866329-10866351 GCTGGTGGGGGGGCAGGTGGGGG - Intergenic
901720597 1:11193977-11193999 GCTGCAGGTGGGACAGGAAGAGG + Intronic
902502796 1:16922030-16922052 GCTGGCGGGGGCACAGGAGGTGG + Exonic
902611743 1:17601992-17602014 GCTGCTGGGGAGACCTGAGGTGG - Intronic
902675610 1:18006552-18006574 GCTGAGGGGGGAACAGAAGAAGG + Intergenic
902936098 1:19765909-19765931 ATTGATGGGGGCAGAGGAGGAGG - Intronic
902972161 1:20061722-20061744 GCTGAAGGAAGGATAGGAGGTGG - Intronic
903191837 1:21660935-21660957 GCTGAGCTGGGGACAGGAGGAGG + Intronic
903283852 1:22265058-22265080 GCTGATTGGGGGTCTGGGGGTGG + Intergenic
903297250 1:22351523-22351545 GGTGTTGGGGGGCCGGGAGGTGG + Intergenic
903918377 1:26780921-26780943 GGTGATGGAGGGAGGGGAGGTGG - Exonic
904703797 1:32375419-32375441 GGTGGTGGGGGGACTGGAGGGGG + Intronic
904771281 1:32882671-32882693 GCAGATGGTGGGACAGATGGAGG - Intergenic
905303761 1:37003843-37003865 GACGAGGGGGGCACAGGAGGTGG - Intronic
905388822 1:37623225-37623247 GGGGATGGGGGGAGAGGAGAGGG + Intronic
905707699 1:40074412-40074434 GAAGCGGGGGGGACAGGAGGAGG - Intronic
905863797 1:41366214-41366236 GCTGATGGGGGTGCGGGAGGAGG + Intronic
905883248 1:41477999-41478021 CCTGATGGGGGGGCAAGATGGGG - Intergenic
905929819 1:41779160-41779182 CCTGGTTGGGGGACAGCAGGAGG - Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906197165 1:43936373-43936395 GCAGATGGGGGTGCAGGCGGCGG - Exonic
906739418 1:48167579-48167601 GGTGGTGGGGGGACAGGGGAGGG - Intergenic
906903609 1:49864857-49864879 GCTGCTGGGGCGAGGGGAGGCGG + Intronic
907880635 1:58546542-58546564 GGGGATGGGGGTACGGGAGGAGG - Intronic
908892786 1:68864454-68864476 GTGGATGGGGAGACAGAAGGGGG + Intergenic
910549851 1:88463212-88463234 TGTGATGGGGAGAAAGGAGGAGG - Intergenic
911164125 1:94709948-94709970 GCTGAGGCTGGGACAGGAGAGGG + Intergenic
911474274 1:98357137-98357159 GCTGATGGGGGGAGAGCAAGAGG - Intergenic
912126923 1:106550970-106550992 GGTGATGGGTGGATAGGTGGTGG - Intergenic
912514032 1:110207030-110207052 GCTCATGGGGGAACAAGAGAAGG - Intergenic
912718793 1:112002611-112002633 GCTGATTGGGGGACACAAAGGGG - Intergenic
912800753 1:112718683-112718705 GGTGCTGGGGGGAAAGGAGCTGG - Intergenic
913092405 1:115486474-115486496 GTTGTTGGGGGAAGAGGAGGGGG + Intergenic
913533198 1:119747724-119747746 GCTGGTGGGGGCAGGGGAGGAGG - Intergenic
915246298 1:154558484-154558506 GCAGCTGGGGGGCCAGGGGGCGG - Exonic
915253778 1:154609608-154609630 GCAGGTAGGGGGAGAGGAGGGGG + Intronic
915440100 1:155940599-155940621 GATCATGGGGAGACAGGATGAGG + Intergenic
915489336 1:156242668-156242690 CCTGATGGCCAGACAGGAGGTGG - Intronic
915994632 1:160550381-160550403 GCTGGTGGGGACACAGGAGAGGG + Intronic
916662716 1:166936815-166936837 GGTGAAAGGGGGAGAGGAGGAGG + Intronic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
919635041 1:199995843-199995865 GTTGCTGGGGGCACAGTAGGTGG - Intergenic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920180969 1:204131509-204131531 CCTGCTGGGGGGACAGGAGAGGG - Exonic
920353915 1:205356454-205356476 GCTGGTGGGGAGACAGGCAGTGG - Intronic
922096305 1:222445882-222445904 ACAGATGAGGGGACATGAGGAGG - Intergenic
923704436 1:236332592-236332614 GCTGCTGATCGGACAGGAGGCGG - Intergenic
924012332 1:239679297-239679319 TCTGATGGGGGCAGGGGAGGAGG - Intronic
924243802 1:242062595-242062617 GCTGTGGAGGGAACAGGAGGAGG + Intergenic
924310842 1:242741775-242741797 GGTGATTGGAGGACAGAAGGTGG - Intergenic
924567906 1:245213242-245213264 GCTGGTGGGGGGCCTGGAGAGGG + Intronic
1062833887 10:623708-623730 GCTGAGGGGAGGAGGGGAGGAGG + Intronic
1063235607 10:4112429-4112451 GCTGTTGGGGGTGGAGGAGGTGG - Intergenic
1063366236 10:5492728-5492750 GCTGATGGTGGCCCAGGAGGAGG + Intergenic
1064038221 10:11934079-11934101 GGTGATGGGGGGAATGGAGGAGG + Intronic
1064392457 10:14953837-14953859 GCTGGAGAGAGGACAGGAGGGGG - Intronic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1064823447 10:19366359-19366381 GCTGATGATCTGACAGGAGGCGG + Intronic
1065440274 10:25746468-25746490 GGTGAAGGTGGGACAGGAGGTGG - Intergenic
1066049411 10:31620372-31620394 GGTGATTTGGGGCCAGGAGGGGG - Intergenic
1066397539 10:35040890-35040912 GCTGCTGATGTGACAGGAGGCGG + Intronic
1066440192 10:35431311-35431333 GAAGATGGGAGGAGAGGAGGAGG - Intronic
1067317556 10:45182258-45182280 CCTGTTGTGGGGGCAGGAGGAGG + Intergenic
1067346297 10:45441322-45441344 GCTGGGGAGGGGAGAGGAGGAGG - Exonic
1067972935 10:50992186-50992208 GCGGATGCGGGGACAGGGAGAGG + Intronic
1068631162 10:59298952-59298974 GCTGGTGGGGAGGAAGGAGGTGG + Intronic
1069559926 10:69422221-69422243 GCTGAGGTGAGGACAGGAGTTGG + Intergenic
1069756573 10:70777393-70777415 GCTGAGGGGAGGAGAGGAGCAGG + Intronic
1069807929 10:71137608-71137630 GGTAATGAGGGGACAGGAGGGGG - Intergenic
1070555922 10:77527725-77527747 GCTGGTGGGGAGTGAGGAGGAGG + Intronic
1071251457 10:83823815-83823837 GTTGATGGTTGGCCAGGAGGTGG - Intergenic
1071436451 10:85652188-85652210 GGTGTGGGGAGGACAGGAGGTGG - Intronic
1072256904 10:93629771-93629793 GCTGATGATCTGACAGGAGGTGG + Intronic
1072416277 10:95249286-95249308 GGTGATCTGGGGCCAGGAGGTGG - Intronic
1072812964 10:98477842-98477864 GCTGCTGGTCTGACAGGAGGTGG - Intronic
1073049944 10:100660900-100660922 GCTGATGTGGGGAGGGGATGTGG + Intergenic
1073293531 10:102425020-102425042 GCTGATGGAAAGACAGCAGGAGG - Intronic
1073351931 10:102826005-102826027 GCTGATGGGGGCAGAGGAACCGG - Intergenic
1073412137 10:103350969-103350991 GCGGGCGGGGAGACAGGAGGCGG + Exonic
1073417230 10:103394744-103394766 GCTGGTGGGGGGGCGGGGGGCGG - Intronic
1074113393 10:110438160-110438182 GCTGCACCGGGGACAGGAGGAGG + Intergenic
1074115721 10:110456445-110456467 CCTGCTGGGGGGGCAGGTGGTGG - Intergenic
1074183027 10:111079363-111079385 TCTGTCGGGGGGACAGGAAGCGG + Exonic
1074527923 10:114277850-114277872 GAAGATGAGGGGGCAGGAGGAGG + Intronic
1074903414 10:117839302-117839324 ACCGATGGGGAGCCAGGAGGGGG - Intergenic
1075277692 10:121109530-121109552 GCTGTTGGGAGCACAGGGGGAGG - Intergenic
1076175480 10:128364683-128364705 GTTGGTGAGGGCACAGGAGGTGG - Intergenic
1076294941 10:129376844-129376866 GGGGGTGGGGGGACAGAAGGAGG - Intergenic
1076727223 10:132419473-132419495 CCTGGTGGGGGGCCTGGAGGAGG + Intergenic
1076815633 10:132913442-132913464 GCTGTTGATGGGACGGGAGGCGG - Intronic
1076979255 11:196241-196263 CCTGGTGAGGGGACATGAGGGGG + Intronic
1077016031 11:399510-399532 GTGGAGGGGGGGACAGGTGGGGG - Intronic
1077287183 11:1772894-1772916 GCTGGTGGGGGGAAAGGTGGAGG + Intergenic
1077305376 11:1866588-1866610 GCTTATGGGGGGCCAGGGGTAGG - Exonic
1077528546 11:3083754-3083776 GCAGATTGGGGGACAGGGGCAGG + Intergenic
1077807974 11:5608585-5608607 GGTGATGGGAGGTCAGTAGGTGG + Intronic
1077864306 11:6210477-6210499 GCTGATGTGGGGGCCAGAGGCGG - Exonic
1077910418 11:6567786-6567808 GCTGAGGGGTGGCCAGGCGGTGG - Exonic
1078966183 11:16346541-16346563 GTGGATTGGGGGAGAGGAGGTGG - Intronic
1078987040 11:16607020-16607042 GCTGGGGAGGGGAAAGGAGGAGG - Intronic
1079290560 11:19184542-19184564 GCAGAGGGGGTGACTGGAGGAGG - Intronic
1080960989 11:37160106-37160128 GCTGATGGGAGGTGAGGTGGTGG + Intergenic
1081022790 11:37968276-37968298 GCTGATAAGGGGACAGGGGGCGG + Intergenic
1081688096 11:45056605-45056627 GAGGATGGGGAGCCAGGAGGAGG - Intergenic
1081737570 11:45414711-45414733 GCTGAGGGGAGGAATGGAGGAGG - Intergenic
1081877456 11:46418983-46419005 GGTGATAGGGGGGCGGGAGGGGG + Intronic
1082791268 11:57348083-57348105 CCTGATGGGGGGAAGGGAAGAGG + Intronic
1083581918 11:63830487-63830509 GCAGCTGGGAGGGCAGGAGGTGG - Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083902554 11:65650664-65650686 GCTGCTTGGAGGCCAGGAGGAGG - Exonic
1084143560 11:67250583-67250605 GGGGCTGGGGGGAGAGGAGGAGG + Exonic
1084320109 11:68368609-68368631 GCTGAAGGGAGGTCTGGAGGTGG + Intronic
1084404656 11:68964288-68964310 GCTGATGGGGAAACAGCAAGCGG + Intergenic
1084476833 11:69394094-69394116 GCTGCTGGGAGGGCTGGAGGTGG + Intergenic
1084562243 11:69911536-69911558 CCAAGTGGGGGGACAGGAGGTGG + Intergenic
1084771288 11:71344309-71344331 ACAGATGGGGGAACAGGAGCAGG - Intergenic
1085032998 11:73283922-73283944 GCTGAAGAGAGGGCAGGAGGTGG + Intronic
1085034614 11:73292594-73292616 GGGGATGGGGGCAGAGGAGGAGG - Intronic
1085038911 11:73315558-73315580 GGTTCTGGGGGGAAAGGAGGAGG + Intronic
1085394675 11:76201257-76201279 GCTGACGCTGGGACAGGAGCAGG + Intronic
1085395857 11:76206740-76206762 CCGGAAGGAGGGACAGGAGGCGG + Intronic
1085423068 11:76380638-76380660 GCTGAGAGGGGCGCAGGAGGCGG - Intronic
1085459134 11:76682611-76682633 GCTGCTGGGGGGAAGGCAGGGGG + Intergenic
1085992135 11:81861931-81861953 GCTGAGGGGGGCAGAGGAGAGGG + Intergenic
1086984446 11:93232942-93232964 GTTTATGGGGGGATAGTAGGGGG - Intergenic
1086988560 11:93277408-93277430 GCTGGTGGGGGGGCTGGACGAGG - Intergenic
1087509541 11:99073540-99073562 GGGGATGGGGGGACAAGGGGAGG - Intronic
1088108150 11:106228674-106228696 GGGGATGGGGGAAGAGGAGGTGG - Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089230924 11:116975362-116975384 GCTGGTGGAGGGATAGGAGTGGG - Intronic
1089346712 11:117796018-117796040 GCAGATGGCGGGAGATGAGGCGG - Intronic
1089577454 11:119455897-119455919 CCTGTTGGGGGTGCAGGAGGAGG - Intergenic
1089846314 11:121461255-121461277 GGTGATGGGTGGGCTGGAGGGGG + Intronic
1091238900 11:134039452-134039474 GCAGTTGGGGGGACAGAAGGTGG + Intergenic
1091705643 12:2691389-2691411 GCAGAGGCGGGGAGAGGAGGCGG + Intronic
1091809228 12:3380965-3380987 TCTGATGGGGGAAGAGGAGATGG - Intergenic
1092658757 12:10716351-10716373 GATGATGGGGGAAGTGGAGGAGG + Intronic
1092762046 12:11819169-11819191 GCTAATGGGAGGTGAGGAGGAGG - Intronic
1093118318 12:15237888-15237910 GCTGTTCAGGGGACAGGAGTAGG + Intronic
1093312618 12:17609068-17609090 GAGGATGGGGGGATAAGAGGAGG + Intergenic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1093980652 12:25471731-25471753 GTTGATGGGAGGAGAGGAGAAGG + Intronic
1094462787 12:30715500-30715522 GGGGCTGGGGGGAGAGGAGGAGG + Intronic
1094703826 12:32896434-32896456 GGTGAGGGCGGGATAGGAGGAGG + Intronic
1095784649 12:46096046-46096068 CCTGTTGGGGGGTCAGGGGGTGG + Intergenic
1096533942 12:52258826-52258848 GCGGAGGGGCGGACAGGTGGAGG - Intronic
1096550500 12:52368900-52368922 GCTGGTGGGGGAAGAGCAGGTGG + Intergenic
1096576974 12:52558937-52558959 GATGAGGGGGTGCCAGGAGGGGG - Intergenic
1097188088 12:57206276-57206298 GCTCAGGGGAGGAGAGGAGGAGG + Intronic
1100135291 12:91545877-91545899 GCAGTTGGGGGGAAAGTAGGGGG - Intergenic
1102330023 12:112021130-112021152 GCTGTTGGGAGGACCGGATGAGG - Intronic
1103667613 12:122582460-122582482 GCTGAGGTGGGGAGGGGAGGAGG + Intronic
1103942543 12:124508884-124508906 GCTGATGGGGGGACAGGAGGTGG + Intronic
1104343706 12:127976849-127976871 GCTGTTGGGTGGACAGGCTGTGG + Intergenic
1104627364 12:130369045-130369067 CCTGTTGGGGGGTAAGGAGGAGG - Intronic
1104647101 12:130505482-130505504 GGTGGTGGGGGGAGTGGAGGGGG - Intronic
1104647222 12:130505771-130505793 GGTGGTGGGGGGAGTGGAGGGGG - Intronic
1104968351 12:132520019-132520041 GCTGGTGGGGGCACTGGAAGAGG - Intronic
1105501314 13:20975155-20975177 GCTGATGGTGGGAACGTAGGGGG + Exonic
1105618569 13:22044923-22044945 TCTTTTGGGGGGACAGGATGGGG + Intergenic
1105845096 13:24287027-24287049 CCTGATGGGGGGGCGGGGGGTGG - Intronic
1106143936 13:27035267-27035289 GCTGATGGGAGGACCCGATGGGG + Intergenic
1106231928 13:27827031-27827053 GCTGATGGGTGGGCTGCAGGTGG + Intergenic
1106559254 13:30834359-30834381 GAGGGTGGGGGGACAGGACGGGG - Intergenic
1109183261 13:59240029-59240051 GCTGATGGGCTGACAGAAGCTGG + Intergenic
1112838461 13:103546303-103546325 GTTGATGTGAAGACAGGAGGAGG + Intergenic
1113353054 13:109548496-109548518 TCTGATGGAGGGTCAGGAGGAGG - Intergenic
1113483493 13:110638353-110638375 GCGGAGAGGGGGACAGCAGGAGG - Exonic
1113505552 13:110813484-110813506 GGTGAGGGGGGGTCAGGAGAGGG - Intergenic
1113747720 13:112756549-112756571 GCGGATGGCGGGGCAGGTGGGGG + Intronic
1113834031 13:113317104-113317126 GCTGTTGCCGGGAGAGGAGGAGG + Intronic
1113929003 13:113956693-113956715 GGGGCTGGGGGCACAGGAGGCGG - Intergenic
1114631891 14:24164516-24164538 GCTGGTGTGGGGAGGGGAGGTGG + Intronic
1115115684 14:29878746-29878768 GCTGAAGGGAGGACAGGAATGGG + Intronic
1118086479 14:62423682-62423704 GGGGATGGGGGGCAAGGAGGGGG + Intergenic
1118196001 14:63626795-63626817 GCTGATGGGGTGTCAGGAAATGG + Intronic
1118501292 14:66364964-66364986 GATGATGGGGGGAGAGTGGGAGG - Intergenic
1118749401 14:68795372-68795394 TCAGCTGGGGGGACCGGAGGAGG + Intronic
1118780323 14:69003608-69003630 GATGATGGGAGGTCAGGTGGGGG - Intergenic
1119019088 14:71091093-71091115 GCTGAGGGGAGGAGAGGAAGTGG + Intronic
1119163380 14:72471706-72471728 GCTGCTGGGTGGTCAGGAGGTGG - Intronic
1119662349 14:76461031-76461053 GACGATGGGGGGAGAGCAGGTGG - Intronic
1121122044 14:91382179-91382201 TCTGCTGTGGGGGCAGGAGGTGG - Intronic
1121272484 14:92647716-92647738 GCTGGTGGCAGGACAGGAAGGGG - Intronic
1121307322 14:92915209-92915231 GCTGATGAGGGGATAAGAGTGGG + Intergenic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121777130 14:96598312-96598334 GGAGATGGGGGAATAGGAGGGGG - Intergenic
1122445037 14:101761835-101761857 GCTGCTGCGGGGGCAGGCGGCGG + Exonic
1122603003 14:102930490-102930512 GCTGGTGAGGGGGCTGGAGGGGG + Exonic
1122634468 14:103123589-103123611 GCCGCGGCGGGGACAGGAGGGGG + Exonic
1122727007 14:103762759-103762781 GCTGCTGTGGGGGCAGGTGGTGG + Intronic
1123158804 14:106257656-106257678 ACTGAGGGCGGGACAGGAGCAGG - Intergenic
1123438392 15:20272473-20272495 GCTGAGGGGAGCAGAGGAGGAGG - Intergenic
1123587474 15:21772749-21772771 GGGGATGGGGAGAGAGGAGGGGG + Intergenic
1123624112 15:22215314-22215336 GGGGATGGGGAGAGAGGAGGGGG + Intergenic
1123932476 15:25178531-25178553 CCATCTGGGGGGACAGGAGGAGG - Intergenic
1123938205 15:25204151-25204173 CCATCTGGGGGGACAGGAGGAGG - Intergenic
1123939439 15:25209713-25209735 CCATCTGGGGGGACAGGAGGAGG - Intergenic
1123940296 15:25213440-25213462 CCATCTGGGGGGACAGGAGGAGG - Intergenic
1124076803 15:26453932-26453954 GTTCAAGGGAGGACAGGAGGAGG + Intergenic
1124095938 15:26648844-26648866 GCAGGTGGGTGGACAGAAGGGGG + Intronic
1124386289 15:29210472-29210494 GCTGATGATCTGACAGGAGGCGG - Intronic
1124394348 15:29288374-29288396 GATGATGGGGAAACAGGAGCAGG - Intronic
1124612805 15:31220087-31220109 GCTGCTGGTCTGACAGGAGGCGG - Intergenic
1125578296 15:40769408-40769430 GCTGATGGCAGGCCAAGAGGAGG + Intronic
1126544112 15:49853676-49853698 GATGATGGGGGGATAGAGGGTGG + Intergenic
1126681417 15:51205757-51205779 GCTTGTGGGAGGAGAGGAGGAGG - Intergenic
1127165642 15:56243362-56243384 GACGAAGGGGGGAGAGGAGGAGG + Intergenic
1127893542 15:63275863-63275885 GATGCTGTGGAGACAGGAGGAGG - Intergenic
1128085110 15:64880802-64880824 GGTCTTGAGGGGACAGGAGGAGG - Intronic
1128154163 15:65382277-65382299 GCTGAAGGAGGGGGAGGAGGTGG + Exonic
1128349805 15:66881294-66881316 GCTCAGGAAGGGACAGGAGGAGG + Intergenic
1128473346 15:67975158-67975180 GCAGTTGGGAGGGCAGGAGGGGG - Intergenic
1129459347 15:75692636-75692658 GGTCATGGGGGCTCAGGAGGGGG + Intronic
1129682824 15:77667585-77667607 GCTGATGGTGGGATAGGAGGGGG - Intronic
1129724615 15:77895250-77895272 GGTCATGGGGGCTCAGGAGGGGG - Intergenic
1129774953 15:78230396-78230418 GCAGAGGGGAAGACAGGAGGTGG - Intronic
1129825652 15:78633484-78633506 GCTGTTGGTGGGAAGGGAGGAGG + Intronic
1129880845 15:79005189-79005211 CCTGAGGTGGGGGCAGGAGGAGG + Intronic
1130102864 15:80906925-80906947 GAGGGTGGGGGAACAGGAGGTGG + Intronic
1130272637 15:82460034-82460056 GGTCATGGGGGCCCAGGAGGGGG - Intergenic
1130464989 15:84187387-84187409 GGTCATGGGGGCCCAGGAGGGGG - Intergenic
1130487699 15:84407417-84407439 GGTCATGGGGGCCCAGGAGGGGG + Intergenic
1130499276 15:84486150-84486172 GGTCATGGGGGCCCAGGAGGGGG + Intergenic
1130507436 15:84558383-84558405 GCTGATAGGGTGCTAGGAGGTGG + Intergenic
1130587279 15:85192001-85192023 GGTCATGGGGGCCCAGGAGGGGG - Intergenic
1130720980 15:86385990-86386012 GGGGATGGGGAGAGAGGAGGAGG - Intronic
1131557745 15:93414244-93414266 GTGGATGGGGGGCCAGAAGGGGG + Intergenic
1131753598 15:95536792-95536814 GCTGCTGATCGGACAGGAGGCGG + Intergenic
1131801213 15:96071267-96071289 GCTGGTGGAGGGACAGCGGGTGG + Intergenic
1131873466 15:96782429-96782451 GAGGATGAGGGGACAGGAGAAGG + Intergenic
1132130734 15:99275990-99276012 GCTGCTGATGGGACAGGAGGTGG - Intronic
1132145889 15:99429734-99429756 GCTTTGGTGGGGACAGGAGGGGG + Intergenic
1132540008 16:504267-504289 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540045 16:504382-504404 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540074 16:504477-504499 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540110 16:504592-504614 GGTGAGGGGGGTACAGGAGGAGG - Intronic
1132540166 16:504771-504793 GGAGATGGGGGTGCAGGAGGAGG - Intronic
1132540210 16:504898-504920 GGAGATGGGGGTATAGGAGGAGG - Intronic
1132739382 16:1403843-1403865 GCGGCTTGGGGGACACGAGGGGG + Intronic
1132896630 16:2232404-2232426 CCTCCTGGGGGAACAGGAGGGGG - Intronic
1132933159 16:2468856-2468878 GCAGGTGGGGGGAGGGGAGGCGG + Intergenic
1133156051 16:3877089-3877111 GCTGAGGGGTTGAAAGGAGGAGG - Intronic
1133211311 16:4264663-4264685 GGTGATAGGGGGACTGGAGCAGG + Intronic
1133254370 16:4507691-4507713 GCTGTGGAGGTGACAGGAGGAGG - Exonic
1133417346 16:5616749-5616771 GGAGAAGGGGGGACAGGAGAGGG - Intergenic
1133479443 16:6155723-6155745 CCTGATGGGAGGACGGCAGGTGG + Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134509001 16:14831344-14831366 GCTGAAGGGGGCAGGGGAGGGGG - Intronic
1134696702 16:16230178-16230200 GCTGAAGGGGGCAGGGGAGGGGG - Intergenic
1134975131 16:18564527-18564549 GCTGAAGGGGGCAGGGGAGGGGG + Intergenic
1135004998 16:18812811-18812833 GTGGGTGGGGGGACAGGAGAGGG - Intronic
1135269595 16:21057667-21057689 GCTGAAGGCAGGACGGGAGGTGG + Intronic
1136403529 16:30030827-30030849 GAGGAAGAGGGGACAGGAGGAGG + Exonic
1137674040 16:50295015-50295037 TCAGATGGGGGCTCAGGAGGAGG + Intronic
1137708297 16:50549577-50549599 GCTGAAAGGAGGCCAGGAGGTGG - Intronic
1137874183 16:51980080-51980102 TGCGATGGGGGGAGAGGAGGAGG - Intergenic
1137950952 16:52782808-52782830 GGTGAGGGGGTGAAAGGAGGTGG - Intergenic
1138218951 16:55233572-55233594 GCTGATGGGGTCACTGGTGGAGG + Intergenic
1138385833 16:56635318-56635340 GCCGATCCGGGGACAGGAGCAGG + Intergenic
1138386335 16:56638216-56638238 GCCGATCCGGGGACAGGAGCAGG + Intergenic
1138508179 16:57489420-57489442 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1138516805 16:57540620-57540642 CCTGATGGGTGGAGAGGAGCTGG + Intergenic
1138568601 16:57852361-57852383 GCTGATGATGAGGCAGGAGGTGG - Intronic
1138580772 16:57939322-57939344 GGAGATGGAGGGAGAGGAGGAGG + Intronic
1138628826 16:58277013-58277035 CCTGATGGGGTGACAGGAGTGGG + Intronic
1139261712 16:65600372-65600394 GCTGATTGGGGGACTGTTGGTGG - Intergenic
1140205265 16:72928095-72928117 GAGGATGGGGGGAGGGGAGGGGG + Intronic
1140264952 16:73412519-73412541 GATGATGGAGGGAAAGGAAGGGG - Intergenic
1140890222 16:79278764-79278786 CCTGACAGGGGGACAGGAGATGG + Intergenic
1141054437 16:80803506-80803528 GCTGGTGCGGGGGCAGCAGGTGG + Intronic
1141193288 16:81840657-81840679 GCTGATGATCTGACAGGAGGTGG + Intronic
1141462012 16:84183328-84183350 GCTGATCTGGGGAGAAGAGGAGG + Exonic
1141592551 16:85078170-85078192 GCTGAATGGGGTAGAGGAGGAGG - Intronic
1141891234 16:86928034-86928056 GCTTATGGGGGAACAGGGAGGGG + Intergenic
1141907066 16:87033763-87033785 GCTGGTTGGGGGACGGGAGTCGG - Intergenic
1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG + Intergenic
1142246545 16:88972798-88972820 ACAAAAGGGGGGACAGGAGGCGG + Intronic
1142678953 17:1534319-1534341 GGGGACGGGCGGACAGGAGGAGG + Intronic
1143137635 17:4720567-4720589 GCGGCTGGGGGGACGGGAAGAGG - Exonic
1143480672 17:7225989-7226011 ACTGCTGGAGGGACTGGAGGTGG + Exonic
1143513136 17:7406640-7406662 GCTGGTGGGGGGGCGGGGGGGGG + Intronic
1143632892 17:8148876-8148898 GCTGGGGAGGGGGCAGGAGGAGG + Intronic
1143649568 17:8255137-8255159 GGTGATGGGGAATCAGGAGGAGG + Intronic
1143687423 17:8529220-8529242 GCTGATGGATGGATAGGGGGTGG - Intronic
1144586287 17:16489859-16489881 GCTGATGGGGGGGTGGGAGGGGG - Intronic
1144713238 17:17416769-17416791 GCTGCTGGGCAGACAGGAAGGGG + Intergenic
1144766916 17:17738034-17738056 GCTGGTGGGTGGGCATGAGGTGG + Intronic
1144833291 17:18143601-18143623 GCTGCTGTGGGAGCAGGAGGTGG + Exonic
1145193735 17:20868960-20868982 GGTGATGGGGGAAAAGGGGGGGG + Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145273680 17:21417824-21417846 GGTGAGGGAGGGACAGGATGTGG - Exonic
1145311866 17:21705266-21705288 GGTGAGGGAGGGACAGGATGTGG - Intergenic
1145936593 17:28717953-28717975 GCAGAAGGGTGGAGAGGAGGGGG - Intronic
1146058562 17:29593125-29593147 GATGATGGGGAGAGAGGAAGGGG - Intronic
1146127403 17:30239778-30239800 GGTGATGGGGTGCTAGGAGGAGG - Intergenic
1146947229 17:36882144-36882166 GCAGGTGGAGGGACAGGAGGAGG - Intergenic
1147416867 17:40298252-40298274 ACTGATGGGGAAAAAGGAGGAGG - Intronic
1147447583 17:40484213-40484235 TCTGATGGTGGGAGAGAAGGAGG - Intronic
1147460878 17:40568356-40568378 CCTGGTGGGGGGAGGGGAGGGGG - Intergenic
1147482387 17:40779120-40779142 GGGGATGGGGGGATAGGAAGAGG - Intronic
1147512616 17:41084391-41084413 GCAGGTGGGGCGACAGCAGGTGG - Exonic
1147513899 17:41097878-41097900 GCAGCTGGGGCGACAGCAGGTGG + Exonic
1147516012 17:41118184-41118206 GCAGCTGGGGCGACAGTAGGTGG + Exonic
1147879533 17:43645036-43645058 GGTGGTGGGTGGAGAGGAGGTGG + Intronic
1148206134 17:45781427-45781449 GCTGCTGGCTGGACAGGAAGGGG + Intergenic
1148555484 17:48576640-48576662 TGGGGTGGGGGGACAGGAGGGGG - Exonic
1148851753 17:50559071-50559093 GCCGATGGGGGGAGGGGATGGGG - Intergenic
1148854061 17:50569143-50569165 CCTGATGTGGGGACAAGAGGTGG - Exonic
1148856723 17:50582989-50583011 GCTGGGGGTGGGGCAGGAGGAGG + Intronic
1149614605 17:57987896-57987918 GCTGCTGAGGTGAAAGGAGGCGG - Intronic
1149971167 17:61219901-61219923 GGTTATGGGGGGAGAGGAGTAGG + Intronic
1150292711 17:63990797-63990819 GCTGCTGTGGGGACGGGGGGTGG - Intergenic
1150427153 17:65086055-65086077 GCAGATGGGGGAGCAGGAGCCGG - Intergenic
1150455857 17:65305939-65305961 GCTGATGATCTGACAGGAGGTGG + Intergenic
1150666879 17:67148131-67148153 ACTGCTGGGGGGCCGGGAGGGGG + Intronic
1150969935 17:70016147-70016169 GCTGATGGGAGGACAGAGTGAGG + Intergenic
1150999026 17:70352141-70352163 GCGGATGGGGAGCCAGAAGGGGG - Intergenic
1151162298 17:72175834-72175856 GAGGTTGGGGGGACAGGGGGTGG - Intergenic
1151182214 17:72337497-72337519 GAAGATGGGATGACAGGAGGAGG - Intergenic
1151182225 17:72337543-72337565 GAAGATGGGATGACAGGAGGGGG - Intergenic
1151318543 17:73338638-73338660 GCTGCTGGGGGGACGGTAGAGGG + Exonic
1151350292 17:73527856-73527878 GATGCTGAGGGGAGAGGAGGTGG + Intronic
1151368754 17:73633946-73633968 GCTGGCGTGGGGACAGGTGGAGG + Intronic
1151696923 17:75722487-75722509 GCTGAGGGAAGGACAGCAGGAGG + Intronic
1151837692 17:76594253-76594275 GGTGATGGTGGGGCAGGTGGAGG - Intergenic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151990722 17:77572372-77572394 TCAGATGGAGGGGCAGGAGGAGG - Intergenic
1152107648 17:78340542-78340564 GATGCTCGGGGGAGAGGAGGAGG - Intergenic
1152124280 17:78437126-78437148 GCTGATGGTGGGTCAGAGGGGGG + Intronic
1152315946 17:79580264-79580286 GAGGATGGGGGGGGAGGAGGAGG - Intergenic
1152336028 17:79700608-79700630 GCTCAGGGAGGGACAGGAGGTGG + Intergenic
1152337504 17:79706950-79706972 GCAGATGGTGGGCCGGGAGGAGG - Intergenic
1153025492 18:668780-668802 GCTATGGGGGGAACAGGAGGAGG + Intronic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1153961824 18:10146837-10146859 ACTGATGGGGGGAGGGGGGGTGG - Intergenic
1155087195 18:22470425-22470447 GCTGATGGGGGGAATAGAAGGGG - Intergenic
1155232229 18:23784673-23784695 GCTGAAGGGGGGATGGAAGGTGG + Intronic
1155741203 18:29290396-29290418 ACAGATGGGGGAACAGGAAGTGG - Intergenic
1156511494 18:37640693-37640715 AGTGATGGGGTGACAGCAGGGGG + Intergenic
1157298002 18:46459685-46459707 GCTGTTTGGGGGACAAGAGAGGG + Exonic
1157313058 18:46566595-46566617 GCTGATGGTGGGGCAGGAATGGG - Intronic
1157573466 18:48729064-48729086 GCAGAGGGGAGGACAGGATGAGG - Intronic
1157579260 18:48764009-48764031 GCTGATGGGGGGTGGGGAGCAGG - Intronic
1157818422 18:50748187-50748209 GCTGAAAGGGGGACATGGGGTGG - Intergenic
1158325422 18:56308596-56308618 GTAGATGGGGGGTCAGGAGAAGG + Intergenic
1158659607 18:59374261-59374283 GCTGAATGGGGAACAGGAAGTGG + Intergenic
1158966295 18:62624981-62625003 GCTGAGGTGGGGATGGGAGGGGG + Intergenic
1159153550 18:64553024-64553046 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1160113202 18:76053405-76053427 GCAGATGCGGGGGCAGGGGGTGG + Intergenic
1160242562 18:77133564-77133586 CCTGATGGTGGAAGAGGAGGAGG + Intronic
1160770989 19:831017-831039 GCTGAGGGCGGCACAGCAGGGGG + Intronic
1160812352 19:1018272-1018294 GGTGCTGGGGAGAGAGGAGGCGG - Intronic
1160820016 19:1053550-1053572 GGTGAGGTGGGGCCAGGAGGAGG + Intronic
1160844262 19:1159638-1159660 GATGGTGGGGGGACAGCAGGGGG + Intronic
1160926525 19:1549391-1549413 GTGGATGGGTGGACAGGAAGGGG - Intergenic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161125190 19:2552034-2552056 ACTGCTGATGGGACAGGAGGCGG - Intronic
1161166807 19:2792053-2792075 GCTGGCATGGGGACAGGAGGAGG - Intronic
1161374084 19:3930085-3930107 GATGGTGGGGGGCAAGGAGGCGG + Intergenic
1161399811 19:4062239-4062261 CCTGCTGGGGGGACAGATGGAGG + Intronic
1161988845 19:7672584-7672606 GCTGCTGGTCTGACAGGAGGTGG + Intergenic
1161996933 19:7718884-7718906 GCTGATGGGGGTGCAGGAAGTGG - Intergenic
1162218032 19:9152480-9152502 GCTGATGATCTGACAGGAGGTGG - Intronic
1162966713 19:14159671-14159693 GCTGATGGGGGGATTAGGGGTGG - Intronic
1163160530 19:15461470-15461492 GCTGCTTGGAGGAGAGGAGGAGG - Exonic
1163406414 19:17125909-17125931 GCGGATGTGGGGGCAGGAAGTGG - Intronic
1163655234 19:18541971-18541993 GCTGCTGGGGGGACAGGAATTGG + Exonic
1163826418 19:19527175-19527197 GCTGCTGGGGGAAGAGGCGGAGG - Intronic
1164109105 19:22138006-22138028 GCGGGCGGGGAGACAGGAGGCGG - Intergenic
1164590711 19:29505330-29505352 TCTGGGGGAGGGACAGGAGGAGG + Intergenic
1164768066 19:30786998-30787020 ACTGATGGGGGCCAAGGAGGGGG + Intergenic
1164873772 19:31668571-31668593 GGTGTTGGGAGGACAGGAGTTGG + Intergenic
1165034362 19:33022373-33022395 GCTGAGGGGGGCAGAGGAGGTGG - Intronic
1165210356 19:34230992-34231014 GCTGCTGATGTGACAGGAGGTGG + Intergenic
1165319264 19:35075651-35075673 GTGGATGGGGGCCCAGGAGGTGG + Intergenic
1165330384 19:35138698-35138720 GCTGGAGGGGGGCCAGGGGGCGG - Intronic
1165433036 19:35783123-35783145 GCTGAGGAGGAGAGAGGAGGAGG + Intronic
1165454610 19:35903487-35903509 TCTGATTTGGGGACGGGAGGTGG - Intronic
1165888851 19:39098850-39098872 GGAGATGGGGGGACTGGTGGGGG - Intronic
1165924694 19:39320082-39320104 GGGGATGGGCGGCCAGGAGGTGG - Intergenic
1166269152 19:41703152-41703174 GGTGATGGGGACACAGGTGGAGG - Intronic
1166290847 19:41862479-41862501 CAAGATGGGGGGACAGGTGGAGG - Intronic
1166345076 19:42160476-42160498 CCTGATGATGTGACAGGAGGAGG - Intronic
1166356558 19:42230638-42230660 GGTGAGGGAGGGACTGGAGGTGG + Exonic
1166381898 19:42359076-42359098 GCTGTTGGGGAGACGGGGGGTGG - Exonic
1166791642 19:45402459-45402481 GCTGTCGCGGGGACAGGCGGTGG + Intronic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1167095460 19:47372993-47373015 GCTGAGGGTGGGACACGAGGAGG - Intronic
1167113745 19:47476744-47476766 GTTGATGGGGGGACAGTGGAGGG + Intronic
1167293657 19:48637388-48637410 GCGGAGGAGGGGGCAGGAGGAGG + Exonic
1167428502 19:49441651-49441673 GCTCAGGAGGGGACAGGACGAGG - Intronic
1168058506 19:53877170-53877192 GCTGATAGTGGGAATGGAGGCGG - Intergenic
1168280192 19:55301663-55301685 GTTGAGGGGGGGACCGGCGGAGG + Intronic
1168345886 19:55650043-55650065 GGGGAGGGGGGGACAGGAGGAGG - Intronic
925230110 2:2225659-2225681 GCTCATGGAGGAGCAGGAGGAGG - Intronic
925981686 2:9182143-9182165 GTTGAGGGGTGGAGAGGAGGAGG + Intergenic
926212582 2:10882059-10882081 CCTGTTGTGGGGGCAGGAGGAGG - Intergenic
926249094 2:11143416-11143438 GCTGAGGGGCTGAAAGGAGGTGG + Intronic
926684473 2:15688223-15688245 GCTGATGGGGGAACAGCCGCAGG - Intergenic
927214005 2:20655992-20656014 GTGGAGGAGGGGACAGGAGGTGG + Intergenic
927666883 2:25039050-25039072 GTTGAGGAGGGAACAGGAGGTGG + Intergenic
927847389 2:26478577-26478599 GCTCATGGGGGGAGAGGGGTGGG + Intronic
928095651 2:28403444-28403466 GCTGATGATGGGAAGGGAGGAGG + Intronic
928278245 2:29921431-29921453 GCTGATGATGGGTGAGGAGGGGG - Exonic
929895884 2:45960572-45960594 GCTGCTGGTCTGACAGGAGGTGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931587106 2:63841047-63841069 GCTGACGGGTGGACAAGGGGGGG + Intronic
932302835 2:70679133-70679155 GGGGATGGGGGACCAGGAGGAGG - Intronic
932435436 2:71700365-71700387 CCTGCAGGGGGGACAGGTGGGGG + Intergenic
932485657 2:72082790-72082812 GCTGAGGGGTGGGCCGGAGGTGG + Intergenic
932598824 2:73110786-73110808 GGTGCTGGGGGAACAGGAGGAGG - Intronic
932605590 2:73163324-73163346 GCCGATGGGGTGAGAGGTGGTGG - Intergenic
932719773 2:74130664-74130686 GGAGATGGAGGGACGGGAGGGGG - Exonic
932773151 2:74512965-74512987 TCTGCTGGGGAGAAAGGAGGGGG + Intergenic
933972852 2:87484111-87484133 GCTGATGTGGGGAAGGGAGAAGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934853861 2:97717247-97717269 GGTGGTGGGGGGGCAGTAGGAGG + Intronic
935211809 2:100945223-100945245 GCTGATCGGAGGACAGGAGGAGG - Intronic
936320869 2:111466102-111466124 GCTGATGTGGGGAAGGGAGAAGG + Intergenic
936472722 2:112813034-112813056 GCAGATGGCTGAACAGGAGGGGG + Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
937037737 2:118795770-118795792 TGTGTTGGGGGGGCAGGAGGGGG - Intergenic
937208386 2:120251868-120251890 GCTGATGGAGGGACTGGATCTGG + Intronic
937320208 2:120956520-120956542 GCTGACTGGGGGATGGGAGGGGG - Intronic
937365348 2:121257265-121257287 GCTGTAGGGGAGGCAGGAGGGGG - Intronic
937875320 2:126820881-126820903 GCTGATGGGGGCTCTGCAGGAGG - Intergenic
937989336 2:127653701-127653723 GCTGCTGAGGGGTCAAGAGGAGG + Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
939889931 2:147724193-147724215 ACTGAAGAGTGGACAGGAGGAGG - Intergenic
940481242 2:154233844-154233866 GCTCATGGATGGTCAGGAGGAGG + Intronic
941403781 2:165063549-165063571 GCTGCTGATGGGACAGGAGGTGG + Intergenic
941591124 2:167422036-167422058 GCTTATGAGGGTAGAGGAGGAGG + Intergenic
941990569 2:171552425-171552447 GCTAATGGGGAGACAGAAGAAGG - Intronic
942238863 2:173940402-173940424 GCTGTTGATGTGACAGGAGGCGG + Intronic
942358073 2:175141253-175141275 GCCCATGGTGGGATAGGAGGAGG - Intronic
942362545 2:175187597-175187619 GGTGATGGGGAGACACTAGGAGG - Intergenic
944655546 2:201873575-201873597 GCTGGTGGGGTGATAGCAGGAGG - Intronic
946020572 2:216637193-216637215 CCAGATGGGGGGAGGGGAGGTGG - Intronic
946060133 2:216934414-216934436 GATGATGAAGGGACAGGGGGAGG - Intergenic
946202117 2:218076480-218076502 GCTGCTGAGGGAGCAGGAGGGGG + Exonic
948157708 2:235797562-235797584 GGGGGTGGGGGGACGGGAGGAGG + Intronic
948777007 2:240294420-240294442 GCAGTTGGGGAGGCAGGAGGAGG - Intergenic
1168798274 20:626788-626810 GCTGATGAGGGCACAGCAGTGGG - Intergenic
1168810406 20:701096-701118 GAAGGAGGGGGGACAGGAGGAGG + Intergenic
1168832118 20:851772-851794 GATGAGGTGGGGACAGGAGCTGG - Intronic
1169367247 20:5001473-5001495 GCTGTCGCGGGGACCGGAGGCGG - Intronic
1169599056 20:7236146-7236168 GCTGTAGGGGGTACAGGGGGAGG + Intergenic
1171227393 20:23452939-23452961 GCTGATGAAGGGGGAGGAGGAGG - Intergenic
1171345416 20:24462137-24462159 GCTGTTGGGGGCACAGGAGCAGG - Intergenic
1172228826 20:33323380-33323402 CCTGATGGAATGACAGGAGGTGG + Intergenic
1172707232 20:36891217-36891239 ACTGATGGATGGACAGGGGGTGG + Exonic
1172764242 20:37342693-37342715 GCTTGTGGAGGGACAGCAGGAGG + Intergenic
1172780894 20:37436424-37436446 GATGATGGGTGGACAGAAGATGG - Intergenic
1173865799 20:46312105-46312127 GCAGATGGGGGGAGGGGAGAAGG - Intergenic
1174182713 20:48684829-48684851 AGTGATGGTGGAACAGGAGGAGG - Intronic
1174194853 20:48765922-48765944 GCTGCTGATGTGACAGGAGGCGG - Intronic
1174270646 20:49365876-49365898 GCTCATGAGGGCACAGGAGCTGG + Exonic
1174354261 20:49987881-49987903 GCTGCAGTGGGGACAGGAGAAGG - Exonic
1174364878 20:50050576-50050598 GGTGATGGGGGCACATGAGTTGG + Intergenic
1174799828 20:53553920-53553942 GGTGATGGGGGCAGTGGAGGGGG + Intergenic
1175073987 20:56358745-56358767 GCTGGTGGGCGGAGAGGAGGCGG + Intergenic
1175191567 20:57215321-57215343 CCTGATGTGGGGAAAGGAGGTGG - Intronic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175427374 20:58877180-58877202 CGTGGTGGGGGGAAAGGAGGGGG + Intronic
1175531028 20:59674416-59674438 GGAGAAGGGGGGACAGGAGAAGG - Intronic
1175531103 20:59674696-59674718 GGAGAAGGGGGGACAGGAGAAGG - Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176301908 21:5102517-5102539 GCAGATGAGGGGACAGGTGAGGG - Intergenic
1176408250 21:6433593-6433615 GATGATGGGAGGGCAGGAGCAGG - Intergenic
1177724028 21:24944103-24944125 GCTGATGATCTGACAGGAGGTGG + Intergenic
1178707330 21:34886804-34886826 GGTGGTGGGAGGACAGGCGGAGG - Intronic
1179547775 21:42124205-42124227 CCTGCTTGGGGGACAAGAGGAGG + Intronic
1179683743 21:43041919-43041941 GATGATGGGAGGGCAGGAGCAGG - Intergenic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1179855122 21:44159383-44159405 GCAGATGAGGGGACAGGTGAGGG + Intergenic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1180794269 22:18594258-18594280 GCTGATGAGGGCACAGGTCGGGG - Intergenic
1180960405 22:19759838-19759860 GCTGGTGAGGGGACAGGCTGTGG - Intronic
1180975815 22:19847547-19847569 GCTCATGCGGGGAGGGGAGGAGG + Exonic
1181227471 22:21401062-21401084 GCTGATGAGGGCACAGGTCGGGG + Intergenic
1181251179 22:21533777-21533799 GCTGATGAGGGCACAGGTCGGGG - Intergenic
1181308210 22:21928872-21928894 TCTAATGGGGGAGCAGGAGGAGG - Intronic
1181484690 22:23223381-23223403 GCCCATTGGGGGACAGGAGCAGG + Intronic
1181528688 22:23503843-23503865 GGTGTTGGGGAGACAGGAAGGGG - Intergenic
1181824988 22:25507753-25507775 GCTGAAGGTGAGCCAGGAGGAGG + Intergenic
1182023510 22:27100236-27100258 GCTTATGGGGGTACAGTGGGGGG + Intergenic
1182425776 22:30271286-30271308 TCTGGTGGGGGGAGAGAAGGTGG + Intergenic
1182532350 22:30969737-30969759 CCAGTTGGGGGGGCAGGAGGGGG + Intergenic
1182550757 22:31099679-31099701 GCTGAGGGGTAGACAGCAGGGGG + Intronic
1182586197 22:31345646-31345668 GCTGCTGAGGGGAAGGGAGGGGG - Exonic
1183093820 22:35540720-35540742 CCTCATCTGGGGACAGGAGGAGG + Intergenic
1183383723 22:37503277-37503299 TCTGGTGTGGGGGCAGGAGGAGG - Intronic
1183642241 22:39099765-39099787 GCTGGCAGGAGGACAGGAGGAGG - Intronic
1183831382 22:40420034-40420056 GCTGAGGCAGTGACAGGAGGAGG - Intronic
1184269449 22:43370499-43370521 TCTGGGGAGGGGACAGGAGGGGG - Intergenic
1184275006 22:43405111-43405133 GCCTATGGTGGGCCAGGAGGGGG + Intergenic
1184362988 22:44030166-44030188 GTTGCTGGGGGGAAAGGCGGGGG - Intronic
1184601950 22:45549010-45549032 GCTGCTGAGGGGAGGGGAGGAGG - Intronic
1184814871 22:46861775-46861797 GCTGACAGTGGGGCAGGAGGTGG + Intronic
1185408741 22:50672155-50672177 GCTGGTGGGTTGGCAGGAGGCGG + Intergenic
949590349 3:5487634-5487656 GCTTATGGGGTGGCAGTAGGGGG + Intergenic
949947479 3:9202057-9202079 GAGGATGGGGGGAAGGGAGGCGG + Intronic
950181848 3:10918938-10918960 GCTGGTGGGGCCACAGGAGCCGG - Intronic
950298268 3:11850832-11850854 GCTGATGGAGGGGAAGGAGAGGG + Intergenic
950624627 3:14235884-14235906 TCTGATGGAGGGACAGAGGGAGG - Intergenic
951943099 3:28103916-28103938 GCAGATGGGTGGACAGGGAGAGG - Intergenic
952585099 3:34882911-34882933 GTAGATGAGGGGCCAGGAGGGGG + Intergenic
952810220 3:37396079-37396101 GCTGGTGGAAGGACAGGAGTAGG - Intronic
953389759 3:42527371-42527393 GCTGTTGGAGGGACAGGGAGAGG - Exonic
954144519 3:48627930-48627952 GATGATGGTGAGACTGGAGGTGG - Exonic
954686590 3:52373346-52373368 GCTGCTGCGGGGGCAGGAAGCGG + Intronic
954715257 3:52523732-52523754 GCTGTGGGGGTGCCAGGAGGGGG - Exonic
954785904 3:53092261-53092283 CCTGGGGAGGGGACAGGAGGAGG + Intronic
955136327 3:56222427-56222449 GATGATGGGGGAGCAGGAGGTGG - Intronic
955885731 3:63596354-63596376 GGAGAGGGGGAGACAGGAGGAGG - Intronic
956646966 3:71465824-71465846 GCTGCTGATGTGACAGGAGGCGG - Intronic
957171615 3:76744444-76744466 GATCATGGGGGCCCAGGAGGTGG - Intronic
957319178 3:78607011-78607033 GCAGGTGGCGGCACAGGAGGTGG + Exonic
957478638 3:80760713-80760735 GCTTGTGGCAGGACAGGAGGGGG - Intergenic
958617041 3:96507649-96507671 GGTGATGGGTTGACAGGTGGAGG - Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960948386 3:122982611-122982633 GTTGGTGGGGAAACAGGAGGAGG - Intronic
960960204 3:123065367-123065389 GATGGTGGGGGGACAGGGGATGG + Intergenic
961333990 3:126159278-126159300 GCTGGTGACGGGGCAGGAGGAGG - Intronic
961428411 3:126863765-126863787 GCTGATGGTGGTGGAGGAGGAGG - Intronic
961630702 3:128296370-128296392 GCTTATGGGTGGCCAGGATGAGG - Intronic
961816992 3:129556175-129556197 GCTGGGGCGGGGGCAGGAGGAGG - Exonic
961821818 3:129579068-129579090 GCTCATGGGGGGACAGCACATGG + Intronic
962022926 3:131518733-131518755 GCTGATGTGGGTCCAGTAGGAGG + Intergenic
962151801 3:132901860-132901882 GCTGCTGGGGGTAGAGGAGGGGG - Intergenic
965363847 3:167774618-167774640 GCTGCTGGTCTGACAGGAGGTGG - Intronic
966594288 3:181712266-181712288 GCGGGCGGGGGGAGAGGAGGAGG - Exonic
966681141 3:182643368-182643390 GATGGTGGGGAGACAGGAGAGGG - Intergenic
966931677 3:184679382-184679404 ACTTATGGGGGGATAGGAAGAGG - Intronic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967597872 3:191349080-191349102 GCTGATGGGGGTGGAGGAGGGGG + Intronic
968163684 3:196447537-196447559 GGTGATGGGGGGTGAGGAGAGGG - Intergenic
968336137 3:197915346-197915368 GTTGAGGGGAGGACAGGATGAGG + Intronic
968489640 4:883164-883186 GCAGAGCGTGGGACAGGAGGGGG - Intronic
969185653 4:5472293-5472315 GCCACTGTGGGGACAGGAGGAGG + Intronic
969520599 4:7675753-7675775 CCTGATGTGGGACCAGGAGGAGG + Intronic
969557775 4:7924971-7924993 GCTGTTGTGGGGGCTGGAGGTGG - Intronic
969626887 4:8310141-8310163 GATGATGGAGTGACAGGTGGGGG + Intergenic
969660602 4:8525351-8525373 GGTGATGGGGCTCCAGGAGGTGG - Intergenic
970525636 4:16929145-16929167 TCTGAGGAGGGGAGAGGAGGTGG + Intergenic
970789882 4:19844657-19844679 ACAGCTGGGGAGACAGGAGGTGG - Intergenic
971015493 4:22485065-22485087 GCTGGTGTGGGGTCAGTAGGTGG - Intronic
971383429 4:26120951-26120973 GATGAAGGGGGGAAAGGAGAGGG + Intergenic
972164166 4:36261891-36261913 GCTTGTGGGGGACCAGGAGGAGG + Intergenic
972351701 4:38242260-38242282 GCTGATGGGGGAAAAAGAGGAGG - Intergenic
972543385 4:40057606-40057628 GCAGATGGGGGCAGGGGAGGCGG - Intronic
973895651 4:55410072-55410094 GCTGGTGGGAGGCAAGGAGGAGG - Intronic
976132300 4:81897555-81897577 GCAGAAGGGGGGAGAGGAGGAGG - Intronic
976462902 4:85333484-85333506 GCTGTTGGGGGGACACGCTGTGG + Intergenic
977323668 4:95549148-95549170 GCTGCTGGGGGGAGCGGCGGAGG - Exonic
978603247 4:110450330-110450352 GCTGGTTGGGGGTCGGGAGGAGG + Intronic
978976688 4:114884282-114884304 GCTGCTGGGGAGGCAGGAAGAGG + Intronic
980102533 4:128555725-128555747 ACTGATGTGGTAACAGGAGGGGG - Intergenic
982298260 4:153852413-153852435 GGTGAAGGGGTGACAGCAGGTGG + Intergenic
983937655 4:173513720-173513742 ACTGATAGGGGGAGAGGAGAAGG - Intergenic
983940363 4:173529861-173529883 GCTGGTGGGGGGAGGGGAAGAGG - Exonic
984930928 4:184846516-184846538 GGGGATGGGGAGACAGGAGCTGG + Intergenic
985060119 4:186069662-186069684 GCTGGAGGGGAGACAGGAGCTGG + Intronic
985693375 5:1325934-1325956 GCTGTGGGAGGGACAGGAAGAGG - Intronic
985923913 5:3000807-3000829 GGTGATGGGGAGAAAGCAGGCGG + Intergenic
985993807 5:3585048-3585070 GAAGAAGGAGGGACAGGAGGAGG + Intergenic
986749241 5:10771696-10771718 GGAGTTGGGGGGAAAGGAGGTGG - Intergenic
987842783 5:23242276-23242298 GCTGATGTGGGGGCTGGCGGAGG - Intergenic
988392932 5:30659026-30659048 GCTGATGATCTGACAGGAGGCGG + Intergenic
988458691 5:31412664-31412686 ACTAAGGGGGAGACAGGAGGAGG - Intronic
988464716 5:31477549-31477571 GCTGGCAGGGGGCCAGGAGGTGG - Intronic
988506138 5:31825073-31825095 CCTGGTGGGTGGCCAGGAGGTGG - Intronic
988528742 5:32008990-32009012 GTTGGTGGGGAGACAGGAGGAGG + Intronic
988824078 5:34916858-34916880 GCAGATTGGGGGGCAGGGGGAGG + Intronic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
988967327 5:36432353-36432375 GTGGATGGGGGGAGGGGAGGGGG + Intergenic
989630035 5:43472799-43472821 GGTGGTGGGGGGTCAGCAGGGGG + Intronic
990676888 5:58196689-58196711 GCTGATCAAGGGGCAGGAGGAGG - Intergenic
990825468 5:59893457-59893479 GGTGATGGGGATGCAGGAGGCGG + Exonic
991735729 5:69630146-69630168 GCTGTGGGGGGGAGGGGAGGGGG + Intergenic
991759343 5:69904997-69905019 GCTGTGGGGGGGAGGGGAGGGGG - Intergenic
991812221 5:70485785-70485807 GCTGTGGGGGGGAGGGGAGGGGG + Intergenic
991815180 5:70506262-70506284 GCTGTGGGGGGGAGGGGAGGGGG + Intergenic
991838570 5:70780063-70780085 GCTGTGGGGGGGAGGGGAGGGGG - Intergenic
991882878 5:71231511-71231533 GCTGTGGGGGGGAGGGGAGGGGG + Intergenic
992073531 5:73170575-73170597 GCTGATTGGAGGGCAGGAGGAGG + Intergenic
994985184 5:106924098-106924120 GCTGCTGGTCTGACAGGAGGTGG - Intergenic
995491224 5:112693223-112693245 CTTGATGGGGGGACTGGAAGAGG + Intergenic
995716097 5:115083120-115083142 GCTGATGGTATGACTGGAGGGGG + Intergenic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
996094336 5:119382213-119382235 GCTGATGGGGTGATAGAGGGAGG - Intronic
996101845 5:119452505-119452527 GCCGACTGCGGGACAGGAGGAGG - Intronic
996811864 5:127524698-127524720 GTTGATGGAGAAACAGGAGGTGG - Exonic
997214036 5:132095682-132095704 GCTGAAGGGTGGAGAGGTGGGGG - Intergenic
997284179 5:132666619-132666641 GCAGTTGGGGGCACAGGAAGTGG - Intergenic
997354658 5:133254573-133254595 GCAGATAGGGGGAAGGGAGGGGG - Intronic
997426366 5:133805312-133805334 GCTGAAGGAGGGAGTGGAGGCGG - Intergenic
997436797 5:133881509-133881531 GCTGATGGGGGCACAGAAGTGGG + Intergenic
997889189 5:137660003-137660025 GCTGATGGTGGTGGAGGAGGAGG - Intronic
998059190 5:139105744-139105766 GCTCAAGGGTGGACTGGAGGAGG - Intronic
1001557797 5:172648077-172648099 GCTGCTGGGGGCACAGCATGGGG - Intronic
1001617906 5:173057052-173057074 TCTGAGGCGGGGACAGAAGGGGG - Intronic
1001686353 5:173597584-173597606 GATGATGGAGGGAAAGAAGGAGG - Intergenic
1001973603 5:175978470-175978492 TCAGATGGTGGGGCAGGAGGTGG - Intronic
1002243830 5:177865309-177865331 TCAGATGGTGGGGCAGGAGGTGG + Intergenic
1002469419 5:179426644-179426666 GCTGAGCGGGGGAAAGGAGGAGG - Intergenic
1002560486 5:180078595-180078617 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1002792353 6:445727-445749 GGAGGTGGGGGGACAGGGGGCGG + Intergenic
1002888745 6:1316947-1316969 GCTGGAGGGGGGGCGGGAGGGGG - Intergenic
1003394055 6:5737790-5737812 GCTGATAGGAGGACTGGAGAGGG + Intronic
1006301594 6:33196335-33196357 GGTTATGAGGGGAAAGGAGGGGG + Intronic
1006457586 6:34140817-34140839 GTTGTTGAGGGGACAGGAAGAGG - Intronic
1007500055 6:42289911-42289933 ACTTATGGGGGTACAGGAGGAGG + Intronic
1008465767 6:51829155-51829177 GCTGGGTGGGGGAAAGGAGGTGG - Intronic
1008480364 6:51979553-51979575 TGTGTTGGGGGGAGAGGAGGAGG - Intronic
1010624117 6:78114792-78114814 CCTGTTGGGGGGACAAGGGGAGG + Intergenic
1011481567 6:87799062-87799084 GCTGATTAGGAGACAGTAGGTGG - Intergenic
1012144045 6:95659140-95659162 GCATGTGAGGGGACAGGAGGAGG + Intergenic
1012623057 6:101372305-101372327 GCTGATGGGGTGAAATCAGGTGG - Intergenic
1012972734 6:105748961-105748983 GCTGGTGGGGGCAGAGGAGGAGG + Intergenic
1013329720 6:109087947-109087969 AGTGATGGGGGGGCAGGGGGCGG + Intronic
1013803271 6:113970752-113970774 GCTGAGGGGTGGGAAGGAGGAGG - Intronic
1013803359 6:113971042-113971064 GCCGGTGGGAGGAGAGGAGGGGG + Exonic
1014930703 6:127332572-127332594 GGTGGTGGGGAGGCAGGAGGTGG + Intronic
1015738771 6:136430908-136430930 GTTGATGGTGGGATAGGCGGTGG - Intronic
1016330222 6:142946377-142946399 GCGGACGGGGGGAGAGGCGGAGG + Intergenic
1016742992 6:147547914-147547936 ACTGATAGGGGAAGAGGAGGTGG + Intronic
1016843037 6:148543801-148543823 ACTGAAGCAGGGACAGGAGGAGG + Exonic
1017007688 6:150039641-150039663 GCAGGAGGAGGGACAGGAGGTGG - Intergenic
1017400069 6:154050616-154050638 GCTGATGGGGGGCTGGGAGGAGG + Intronic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1018710688 6:166496477-166496499 GTTTCTGGGGGGACAGGGGGAGG - Intronic
1018894343 6:168002967-168002989 GCTGCTGGTCTGACAGGAGGTGG + Intronic
1018936370 6:168276306-168276328 GGGGCTGAGGGGACAGGAGGAGG + Intergenic
1019351728 7:557152-557174 GGAGATGGGAGGGCAGGAGGAGG - Intronic
1019690270 7:2406542-2406564 GCTGAACAGGGCACAGGAGGAGG + Intronic
1020594643 7:10190559-10190581 GCTGGTGGGAGGACAGTAGTGGG + Intergenic
1022104757 7:27189800-27189822 ACTGTAGGGGGGACAGGAGCAGG - Intergenic
1022378167 7:29834785-29834807 GCTGATGGTGGGGGAGGGGGAGG - Exonic
1022541476 7:31139785-31139807 ACTGAGGGGTGGGCAGGAGGGGG - Intergenic
1022983453 7:35626390-35626412 GCTGTTGGTCTGACAGGAGGTGG - Intergenic
1023081362 7:36529574-36529596 GCGGATGGGGGCACTGGGGGTGG + Intronic
1023113358 7:36836653-36836675 GAGGATGGGGGGGCAAGAGGAGG + Intergenic
1023474941 7:40566997-40567019 GCTTTTGGGGGGACAGGCGAGGG - Intronic
1023626676 7:42121721-42121743 CCTGATGGAGGGGGAGGAGGTGG - Intronic
1023862364 7:44224348-44224370 CCTGATGGAGGGAAAGGAGGGGG + Intronic
1024062027 7:45704963-45704985 GCTGATGGGAGGAGAAGAGAGGG - Intronic
1024111816 7:46154744-46154766 CCTGATGAGGCAACAGGAGGAGG - Intergenic
1024235317 7:47393349-47393371 GGGGATGGAGGGTCAGGAGGAGG + Intronic
1024542886 7:50493303-50493325 GCTGATGGGCTGTCCGGAGGAGG - Intronic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1024912578 7:54463090-54463112 GAGGATGGAGAGACAGGAGGGGG - Intergenic
1025991927 7:66503503-66503525 GCTTCTGGGGGGAGAAGAGGGGG - Intergenic
1026673401 7:72408787-72408809 GCTACTGAGGGGACTGGAGGTGG - Intronic
1026978977 7:74515670-74515692 GCCCATAGTGGGACAGGAGGGGG - Intronic
1027201431 7:76066198-76066220 GCTGATGGAGCGACAGGTCGGGG + Intronic
1027428212 7:78082999-78083021 ACTTATCGGGGGACAGCAGGAGG + Intronic
1028288303 7:89032295-89032317 TGTGTTGGGGGGACAGGATGTGG + Intronic
1028479300 7:91287224-91287246 TGTGATGTGGGGTCAGGAGGGGG - Intergenic
1028602350 7:92616008-92616030 GTTGATGGAAGGAGAGGAGGAGG - Intronic
1028932951 7:96434115-96434137 ACTGGTGGGGGGACAGGAATGGG - Intergenic
1029508215 7:100975685-100975707 GCTGATGAGGGTACAGGGAGAGG + Intronic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1029646716 7:101861557-101861579 ACTGAGGGTGGGACAGGCGGAGG + Intronic
1032257139 7:130306259-130306281 GCTGCTGGGAGGGCAGCAGGAGG + Intronic
1032405689 7:131653737-131653759 GGAGATGGGGGGACAGTGGGAGG + Intergenic
1033145843 7:138869469-138869491 GCTGCGGGGGGCACAGGAGCAGG - Intronic
1033257814 7:139817206-139817228 GCTGATGGGGGGCTGGGACGGGG - Intronic
1033275527 7:139968692-139968714 TTTGATGGTGGGACAAGAGGAGG - Intronic
1034339319 7:150341693-150341715 GCTGGAGGGGGTCCAGGAGGTGG - Intergenic
1034466561 7:151233194-151233216 GCTGCTGAGGAGACAGCAGGCGG - Exonic
1034748335 7:153544278-153544300 ACAGATTGGGGGACTGGAGGAGG - Intergenic
1034926887 7:155129833-155129855 ACTGCTGGAAGGACAGGAGGTGG + Intergenic
1034992538 7:155557286-155557308 GCTGATGGGGAGAGAGCTGGAGG + Intergenic
1035111226 7:156483709-156483731 GAGGAGGGGGAGACAGGAGGGGG + Intergenic
1035195271 7:157214089-157214111 GGAGATGGGGAGAAAGGAGGAGG - Intronic
1035199097 7:157248577-157248599 GCAGGTGAGGGGTCAGGAGGAGG + Exonic
1035249054 7:157585142-157585164 GCTGATGAGGGGGCAGCGGGAGG + Intronic
1035278129 7:157760129-157760151 GGTGATGTGGGGGCAGAAGGAGG - Intronic
1035290791 7:157837284-157837306 GCAGGTGGGTGGACAGGTGGTGG - Intronic
1035312409 7:157977812-157977834 GCTGCTGGGGGAGCAGGAAGGGG + Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1036579834 8:10063564-10063586 GGTGATGGGGGATTAGGAGGTGG + Intronic
1036643461 8:10598185-10598207 ACTGAAGTGGGGACAGGAAGGGG + Intergenic
1037485890 8:19346321-19346343 GCTGATGATCTGACAGGAGGCGG - Intronic
1037637099 8:20710014-20710036 CCTGTTGCGGGGGCAGGAGGAGG - Intergenic
1037734930 8:21558198-21558220 GCTGATGATCTGACAGGAGGCGG + Intergenic
1037837398 8:22222207-22222229 GTGGATGGGGTGGCAGGAGGTGG - Intronic
1038231900 8:25708343-25708365 GGGGATGGGGGGAAGGGAGGAGG + Intergenic
1039070716 8:33647176-33647198 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1040599379 8:48869385-48869407 GCTGGTGGGGGCCCGGGAGGTGG + Intergenic
1040637970 8:49297969-49297991 GCTGGTGGGGGTACAAGAAGGGG + Intergenic
1040669642 8:49673920-49673942 GCTGTTGTGGGGGTAGGAGGAGG + Intergenic
1040725748 8:50379411-50379433 GCCGATGGGGGGTCAGGGGCAGG + Intronic
1040807060 8:51406609-51406631 GATGATGGGGGAACACCAGGTGG - Intronic
1041175718 8:55194035-55194057 ACTGAAAGGTGGACAGGAGGGGG - Intronic
1041928276 8:63260355-63260377 GCTGATGATCTGACAGGAGGCGG - Intergenic
1042117164 8:65444823-65444845 GCTCATGGGGGGGCAGGGGGGGG - Intergenic
1042173179 8:66012212-66012234 GTTGATGGGGGGTCGGGGGGAGG + Intergenic
1042999637 8:74742125-74742147 GCAACTGGGGGGACAGGAGGTGG - Intronic
1043863046 8:85343527-85343549 GCTCATGGAGTGACAGGAGCAGG + Intronic
1045290685 8:100830117-100830139 GCTGCTGAGCTGACAGGAGGTGG - Intergenic
1045343807 8:101276601-101276623 ACTGATGGAGGCACAGGAGTTGG + Intergenic
1047219676 8:122909595-122909617 GTTGTGGGGGGGAGAGGAGGAGG - Intronic
1047492811 8:125388422-125388444 GCTGATGGGGGAAAAGGTAGCGG + Intergenic
1048043016 8:130749024-130749046 ACAGATGTGAGGACAGGAGGAGG + Intergenic
1048171907 8:132115294-132115316 TCTGATGTGGGGACAGGACATGG + Intergenic
1048299338 8:133239750-133239772 GCTGATGGGGTGGAATGAGGAGG + Intronic
1048571162 8:135658002-135658024 GCTGATGGGCAGATGGGAGGAGG + Intergenic
1048592551 8:135834184-135834206 CCTGATGGAGGGAGAGGAGCTGG + Intergenic
1049206923 8:141367841-141367863 GCTGTGTGGGGGGCAGGAGGGGG + Intergenic
1049206939 8:141367932-141367954 GCTGTGTGCGGGACAGGAGGTGG + Intergenic
1049288692 8:141790502-141790524 GCTGCTGGGGGGACAGGCTGAGG + Intergenic
1049421979 8:142521030-142521052 GCGGGTGTGGGGGCAGGAGGAGG + Intronic
1049469649 8:142769630-142769652 GATGGTGGGGGGACAGGAATGGG + Intronic
1049504181 8:142986030-142986052 GCTGGTGTGTGGACAGCAGGTGG - Intergenic
1049510612 8:143025000-143025022 GCTGCTGGGCGGCCAGGCGGGGG + Intergenic
1049521641 8:143094503-143094525 GCTCATGCGGGCACAGCAGGAGG - Intergenic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049616919 8:143579562-143579584 GGAGATGGAGGGACAGGCGGAGG + Intergenic
1049644239 8:143728907-143728929 GGTGCTGGGGTTACAGGAGGAGG + Intronic
1049654906 8:143793162-143793184 GCAGGCGGGGGGACAGGCGGGGG - Intronic
1049680782 8:143917044-143917066 GCTGATGGGGTAGGAGGAGGAGG + Exonic
1049682910 8:143927688-143927710 GCTGCGGGGGGCACAGGAGGTGG - Exonic
1049803779 8:144529938-144529960 GCCGAGGGAGGGAGAGGAGGCGG + Exonic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050711743 9:8473360-8473382 GATGGTGGGAGGACAGGAGAGGG - Intronic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1052974004 9:34398779-34398801 GATGATGGGGGCACAGGGGTTGG + Exonic
1053016342 9:34664463-34664485 GCTGATTGGGTGACAGAAGGGGG + Exonic
1053186562 9:36021508-36021530 GCTGATGGGGAATGAGGAGGAGG + Intergenic
1053463329 9:38287612-38287634 GCTGATGGGCAGATAGGAAGGGG - Intergenic
1054811921 9:69441935-69441957 TCTGATCAGGGGACAGGAGCAGG - Intronic
1057083243 9:92188302-92188324 GCAGATGGAGGGACAGTGGGTGG + Intergenic
1057581545 9:96291434-96291456 GCTGTGGGAGGGAGAGGAGGGGG - Intronic
1057790615 9:98122413-98122435 GCTGAGGTGGGGACTGCAGGAGG - Exonic
1059352706 9:113676936-113676958 GCTCCTGGGGGGGCAGGTGGAGG + Intergenic
1059415131 9:114157489-114157511 GCTGGTGGAGGCACAGGAGAGGG - Intronic
1059525840 9:114990149-114990171 GGTGATGGGGGGACAGCCTGGGG + Intergenic
1059734340 9:117086653-117086675 GCTGGGTGAGGGACAGGAGGAGG - Intronic
1060003730 9:119981372-119981394 GCTGATGGGGAGACAGGGCAGGG - Intergenic
1060110635 9:120904214-120904236 GCTGATGGAGGCACAGGATGTGG + Exonic
1060209049 9:121699300-121699322 GCGCACGGGGGGACAAGAGGGGG - Intronic
1060216408 9:121741129-121741151 GCGCATGTGGGGAGAGGAGGGGG - Intronic
1060400319 9:123344754-123344776 GCTGCTGGGGAGAGGGGAGGAGG + Intergenic
1061056601 9:128226001-128226023 GAGGAGGTGGGGACAGGAGGAGG - Intronic
1061412360 9:130428489-130428511 GGTGATGGGGGCACAGCATGCGG + Exonic
1061642316 9:131968861-131968883 GCTGCTGAGCTGACAGGAGGTGG - Intronic
1061777104 9:132972979-132973001 GCTGAAGGGTGGACAGCAGTGGG - Intronic
1061844250 9:133378029-133378051 GCTGCTGAGCTGACAGGAGGTGG + Intronic
1062345829 9:136114742-136114764 GGTGAAGGTGGGACGGGAGGCGG - Exonic
1062392153 9:136338124-136338146 GCTCATGGGGAGGCAGGCGGTGG + Intronic
1062610184 9:137370021-137370043 GCAGCTTGGGGGACAGGACGAGG + Intronic
1062712927 9:137986530-137986552 GCTGTTTGGGGGACAGTAAGTGG + Exonic
1062729790 9:138102491-138102513 GGGGGTGGGGGGCCAGGAGGGGG + Intronic
1186658244 X:11639816-11639838 GTTGGTGGGGGGTCAGGAGCAGG - Intronic
1186691355 X:11979133-11979155 ACTGCTGGGTGGACAGGAAGCGG - Intergenic
1187026595 X:15441672-15441694 GATGAGGGGGAGGCAGGAGGTGG + Intronic
1187178248 X:16916625-16916647 GCTGTTGGGGGGGGAGGGGGAGG - Intergenic
1187570652 X:20497477-20497499 GCTGATAGGGGGAAAGGTTGGGG - Intergenic
1188356623 X:29199661-29199683 GCTGCTGATGTGACAGGAGGCGG + Intronic
1189355325 X:40306083-40306105 GGTGAGGCGGGGACAGGATGAGG + Intergenic
1189388520 X:40557005-40557027 GCTGGTGGGGGGTGAAGAGGGGG - Intergenic
1190562001 X:51695389-51695411 GCTGATGAGGGTTCAGAAGGAGG + Intergenic
1195803022 X:108734426-108734448 GCTGGTGGGGGTGGAGGAGGAGG + Exonic
1195860323 X:109376091-109376113 ACTGGTGGGGGCACAGGAAGGGG + Exonic
1195988263 X:110656442-110656464 CCTGTTAGGGGGACAGGGGGAGG + Intergenic
1196297442 X:114015173-114015195 GCGGAGGGGGGGACAGGGGGAGG + Intergenic
1196547618 X:116981461-116981483 GCGGATGGGGGGCTAGGAGAGGG + Intergenic
1197758392 X:130011805-130011827 ACTGATGGGGGGGCAGGGAGGGG + Intronic
1198065090 X:133088433-133088455 GCTGCTGAGCTGACAGGAGGTGG + Intronic
1199411479 X:147528622-147528644 TCTGATGGGGGGGGAGGAGGAGG - Intergenic
1200179847 X:154143651-154143673 GCTCATGGGGGGCAAGGGGGAGG + Intergenic
1202370247 Y:24191302-24191324 GGTCATGGGGGCCCAGGAGGGGG + Intergenic
1202500537 Y:25478815-25478837 GGTCATGGGGGCCCAGGAGGGGG - Intergenic