ID: 1103942705

View in Genome Browser
Species Human (GRCh38)
Location 12:124509654-124509676
Sequence CCTTCCCCCTACACTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103942705_1103942711 -5 Left 1103942705 12:124509654-124509676 CCAGACTCAGTGTAGGGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1103942711 12:124509672-124509694 GAAGGGGCCAGGCAGGAGCCAGG 0: 1
1: 1
2: 10
3: 116
4: 1002
1103942705_1103942713 1 Left 1103942705 12:124509654-124509676 CCAGACTCAGTGTAGGGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1103942713 12:124509678-124509700 GCCAGGCAGGAGCCAGGGAGAGG 0: 1
1: 2
2: 18
3: 155
4: 1326
1103942705_1103942717 24 Left 1103942705 12:124509654-124509676 CCAGACTCAGTGTAGGGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1103942717 12:124509701-124509723 CCTGTCCTGTGTCACCCTGAAGG 0: 1
1: 0
2: 0
3: 29
4: 220
1103942705_1103942718 25 Left 1103942705 12:124509654-124509676 CCAGACTCAGTGTAGGGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1103942718 12:124509702-124509724 CTGTCCTGTGTCACCCTGAAGGG 0: 1
1: 0
2: 1
3: 22
4: 216
1103942705_1103942712 -4 Left 1103942705 12:124509654-124509676 CCAGACTCAGTGTAGGGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 126
Right 1103942712 12:124509673-124509695 AAGGGGCCAGGCAGGAGCCAGGG 0: 1
1: 2
2: 18
3: 83
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103942705 Original CRISPR CCTTCCCCCTACACTGAGTC TGG (reversed) Intronic
900614071 1:3556525-3556547 GCTTCCCACTCCAGTGAGTCAGG + Intronic
901246789 1:7738080-7738102 GCTTCCCACTGCACTGAGTCTGG + Exonic
905867996 1:41386707-41386729 CCTTCTCTCTACAGTGAGGCTGG + Intergenic
907670704 1:56472711-56472733 CCTCACCCCTACCCTGAGCCTGG + Intergenic
908000142 1:59671515-59671537 CCCTCCACCTACTCTGAGCCTGG - Intronic
910928804 1:92422401-92422423 CCTTATCACTACACTTAGTCTGG + Intergenic
912134885 1:106648889-106648911 CCTTCCCCCTCCTCTAAGTTTGG - Intergenic
912381591 1:109250540-109250562 CCTTTCCCCTGCCCTGAGCCCGG - Exonic
913490453 1:119374872-119374894 CCTTCCTCCTTCCCTCAGTCAGG + Intronic
915045490 1:153010725-153010747 CCATCCCACTAGACTGAGTAAGG - Intergenic
915147279 1:153802583-153802605 GCTTCCCTCCACTCTGAGTCTGG - Intergenic
915972682 1:160365543-160365565 CCTGCCCCCATCCCTGAGTCTGG - Intergenic
919464602 1:197913493-197913515 ATTTCCCCCTACACTGAGGTTGG - Intronic
919820914 1:201471318-201471340 TCTTCTCCCCACACTGGGTCTGG + Intergenic
920261953 1:204694221-204694243 GCATCCCCATACATTGAGTCGGG + Intergenic
922777096 1:228219975-228219997 CCGTCCCCACACACTGAGTCTGG - Intronic
1063414046 10:5858902-5858924 TCTGCCCCCTACACTAATTCTGG + Intergenic
1063890545 10:10623668-10623690 TCTTCCCCCTCCACTGTCTCTGG - Intergenic
1067548830 10:47219026-47219048 CCCTGCCCCTGCCCTGAGTCTGG + Intergenic
1069546921 10:69335302-69335324 CCTTCCCCTTTCACACAGTCTGG - Intronic
1073293859 10:102426581-102426603 ACTTCTCCCTATCCTGAGTCTGG + Intronic
1076554921 10:131315039-131315061 TCCTCACCCTGCACTGAGTCAGG - Intergenic
1079004713 11:16783555-16783577 CCTGCCCCCTCCAATGAGTAGGG + Intronic
1080158531 11:29143216-29143238 CCTCCCCCCTCCCCCGAGTCAGG + Intergenic
1086470637 11:87105929-87105951 CCTTTCCCCTACACAGCTTCTGG + Intronic
1086493218 11:87376488-87376510 CCTTCACCAGACACTGAATCTGG + Intergenic
1089556923 11:119320169-119320191 CCTTCCTCCTGCCCTGGGTCAGG - Intronic
1096464061 12:51838508-51838530 CCTTCCCCCTCCCATGACTCAGG + Intergenic
1099077696 12:78131223-78131245 CCTTCCCACTATATTGAGTAGGG + Intronic
1100239271 12:92694546-92694568 CCTTCCCCCAACACAGAACCAGG - Intergenic
1100399940 12:94220747-94220769 CCTTCCCCCTCCACCATGTCTGG - Intronic
1102237626 12:111304135-111304157 CCTTCTCCCTGCACTGTTTCAGG - Intronic
1103555986 12:121766696-121766718 CCTCACCCCCACACTCAGTCTGG - Intronic
1103942705 12:124509654-124509676 CCTTCCCCCTACACTGAGTCTGG - Intronic
1105997025 13:25682341-25682363 CCTTCCCCTGAGTCTGAGTCTGG + Intronic
1106057506 13:26252392-26252414 GCTTGCCCCTACACTGTATCGGG - Intergenic
1106928780 13:34641122-34641144 CATCCCCCTTAGACTGAGTCTGG + Intergenic
1111101974 13:83599847-83599869 CATTGCCCCTACACTCAGGCAGG - Intergenic
1118959566 14:70516527-70516549 CCCTCCTCCTACTCTGAGCCTGG - Intergenic
1119325309 14:73756588-73756610 CCTGCCACCTGCAGTGAGTCAGG + Intronic
1121420055 14:93806853-93806875 GTCTCCTCCTACACTGAGTCAGG + Intergenic
1128772436 15:70292301-70292323 CTTTCCCCCTTCACTGGGCCTGG - Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131766452 15:95681010-95681032 CCTTCCCCTTCCACTGTGACTGG + Intergenic
1132061331 15:98694526-98694548 CATCCCCCCCACCCTGAGTCTGG - Intronic
1132667796 16:1089994-1090016 CCTTCGCCCCACACTGAGGTGGG - Exonic
1132856731 16:2048325-2048347 CCTAACCCGTGCACTGAGTCGGG + Intronic
1134429828 16:14193095-14193117 CCCTCCCCCTACACACATTCTGG + Intronic
1135489260 16:22894364-22894386 CCTTCCCCCTACCCACAGCCAGG - Intronic
1136369953 16:29830212-29830234 ACTTCCCCCTACACTGCCACCGG - Intronic
1139357690 16:66377159-66377181 CCTGCCGCCTCCCCTGAGTCAGG + Intronic
1140457997 16:75115716-75115738 CCTCCCCCCGACACTGGGGCAGG - Intronic
1142988929 17:3716080-3716102 CCTTCCCCCCACCCTGACCCCGG - Intronic
1143114981 17:4577092-4577114 CCTTCCCCCTTCTCAGAGACGGG - Intergenic
1145051012 17:19660732-19660754 CTTTCCCCCTACAGTAAGTTCGG - Intronic
1147327889 17:39678591-39678613 CCTTCCCCCAAGACTTAGCCCGG + Intronic
1147704503 17:42416718-42416740 CCTTCCTCCCAAACTGAGTTTGG - Intronic
1151955712 17:77379215-77379237 CCATACCCCTACACTGGGCCCGG + Intronic
1152601445 17:81264216-81264238 GCTTCCCCCGCCACTGAGGCTGG - Intronic
1152609269 17:81307562-81307584 CCCTCCCCCTTCTCTGAATCAGG + Intergenic
1154333983 18:13451683-13451705 CCCTCGCCAGACACTGAGTCCGG - Intronic
1155167106 18:23240350-23240372 CCTTCCCCCTACACACACACAGG + Intronic
1156938461 18:42738375-42738397 CCTCCCCCCTACACCCGGTCAGG + Intergenic
1158393519 18:57062355-57062377 CCTTCACCCTCCACTGAGAGGGG + Intergenic
1158395998 18:57078730-57078752 CCCTCCCCCTTCTCAGAGTCAGG + Intergenic
1163186006 19:15640250-15640272 CTGTCCTCCTATACTGAGTCCGG + Intronic
1163479936 19:17549253-17549275 CCTGCACCCTTCACTGAGCCTGG - Intronic
1163779528 19:19239303-19239325 CCTCCAGCCTACACTGAGGCTGG + Intronic
1163843776 19:19627692-19627714 TCTGCTCCCTACACTGACTCCGG - Intronic
1166540372 19:43601344-43601366 CATTCAACCTACTCTGAGTCTGG + Intronic
1167705357 19:51078330-51078352 CCTTCCCTCTCCGCTGGGTCTGG + Intronic
926740420 2:16105894-16105916 CCTTCCCATTCCCCTGAGTCTGG + Intergenic
926957677 2:18319350-18319372 GCTTCCCTCCACTCTGAGTCGGG - Intronic
931064787 2:58573249-58573271 CCTTCCCCCTCCACTCATTAGGG - Intergenic
934886529 2:98030231-98030253 CCAGCCCCCCACACTGAATCAGG - Intergenic
935694682 2:105761056-105761078 CCTTCCTCAGACACTGGGTCGGG - Intronic
935736009 2:106107204-106107226 CCTTCCCACCACACTCAGTCAGG + Intronic
938233181 2:129679258-129679280 CCTTCCCCCTCCATTGATTCTGG - Intergenic
943299914 2:186185851-186185873 CCTTCCCCCTACCCTGCGACAGG - Intergenic
946052188 2:216872517-216872539 CCACACCCCTACACTGAGTAAGG - Intergenic
948856649 2:240733361-240733383 CCCTCTCCCTGCAGTGAGTCTGG - Intronic
1170800534 20:19586523-19586545 CCTTCCCCCTACCCTTTGCCAGG + Intronic
1173857710 20:46261487-46261509 CCTTTCCCCTAGCCTGAGTCTGG - Intronic
1175402720 20:58709677-58709699 CCTTCCCTGTACACTGCCTCTGG - Intronic
1176029283 20:63003701-63003723 CCTTCCCCCAACACTCAGGGAGG - Intergenic
1177166895 21:17613083-17613105 CCCTCGCCCTACCCTGAGCCTGG + Intergenic
1182916411 22:34036744-34036766 CCTTCTCACTACTCTGAGTGAGG - Intergenic
1183431161 22:37766523-37766545 CCTTCCCCCTCAGCAGAGTCTGG + Intronic
951252100 3:20405711-20405733 CCTTTCTCCCTCACTGAGTCAGG + Intergenic
953346124 3:42177534-42177556 ACTGCCCCCTTCACTGAATCAGG + Intronic
954134129 3:48574363-48574385 CCATCCCCCTAGACAGAGTCAGG + Intronic
956165766 3:66397176-66397198 CCTTCCCTCCTCACTCAGTCTGG + Intronic
956454080 3:69403509-69403531 CCTTCCCCCTGAAATGAGTGGGG + Intronic
960051356 3:113241905-113241927 CCTCCTCCCTTCTCTGAGTCAGG - Intronic
961593672 3:127999701-127999723 TCTACCACCTACACTGAGGCAGG - Intergenic
962283557 3:134069349-134069371 CCTTCCCCACACAGTCAGTCTGG - Intronic
962952211 3:140229635-140229657 CCTTCCTCCTTCACTCACTCAGG - Intronic
967193362 3:187004515-187004537 CCTTCCTCCTACACTGCCTATGG - Intronic
969135418 4:5025129-5025151 CCTTCCCCCTTCTCTGACTCAGG + Intergenic
969139250 4:5054337-5054359 CCCTCCCCCCACTCTGAGTTAGG - Intronic
969339247 4:6529971-6529993 GCTTCCCCCAGCACTGAGTGTGG - Intronic
969734340 4:8977045-8977067 CCTTTCCGGAACACTGAGTCTGG - Intergenic
973590535 4:52436529-52436551 CTTTGCCCCTACACCAAGTCAGG + Intergenic
974811842 4:66955961-66955983 GCTTCCCCCTTCACTGACACTGG - Intergenic
982845620 4:160247839-160247861 GCTACAGCCTACACTGAGTCAGG - Intergenic
983098010 4:163588177-163588199 CCTTCCCCCTGAACTGACTTAGG + Intronic
985718734 5:1477367-1477389 CCTTCCCCCATCGCCGAGTCAGG - Intronic
990825006 5:59889318-59889340 CCTTCTACCTAAATTGAGTCAGG + Intronic
992499490 5:77327867-77327889 CCTTCCCCCCACACAGTGTGAGG + Intronic
997357612 5:133273843-133273865 CCTTCCCCCAAGCATGAGTCAGG + Intronic
1002910702 6:1488995-1489017 TCTTCCCCCAAGACAGAGTCTGG - Intergenic
1003514830 6:6809281-6809303 TCTTCCCCCTTCACTGTGCCTGG - Intergenic
1006941738 6:37756205-37756227 CCTGCCCCCTTCACTGAGGGTGG - Intergenic
1007607644 6:43128192-43128214 CCTTCCCCCAATACAGACTCAGG - Intronic
1010180083 6:73076189-73076211 CCTTCTCCCTGCACTGAGAAAGG - Intronic
1011700403 6:89950119-89950141 CCTTCCCCATCCACAGAGGCAGG - Intronic
1011788083 6:90868491-90868513 CCTTCCACATCCACTAAGTCAGG - Intergenic
1016532048 6:145069636-145069658 CCTTCACCAGACACTGAATCTGG - Intergenic
1017313667 6:153003053-153003075 TCTTTCCCATGCACTGAGTCGGG + Intergenic
1017803495 6:157921856-157921878 GCTTCCCCCTACACTGGGAGTGG + Intronic
1018485016 6:164232335-164232357 CATTCCTGCAACACTGAGTCAGG + Intergenic
1018972057 6:168536653-168536675 CCCTCTCTCCACACTGAGTCCGG - Intronic
1024888068 7:54167440-54167462 CCTTCCCTCTTCACTGTGTTTGG - Intergenic
1027216266 7:76185787-76185809 CCTTCCCCCAACACAGAATCAGG - Intergenic
1029861525 7:103577427-103577449 CCTTCCTCTTACACTGAAACGGG - Intronic
1033329181 7:140404018-140404040 CCTCCCACCTGCCCTGAGTCCGG - Intronic
1037795887 8:21994519-21994541 CCTTCCCCCTACACCGTCTCTGG - Intronic
1038317572 8:26500886-26500908 CCTTCCCCCAACACTCACTGTGG - Intronic
1042804394 8:72756099-72756121 CCTTCCCACTACAATGAGCTGGG - Intronic
1045297233 8:100882614-100882636 AGTTCCCCCTACATTGAATCTGG - Intergenic
1045322227 8:101090941-101090963 CCTTACTCCTACACTCTGTCCGG - Intergenic
1046546511 8:115658000-115658022 TCTTCCCCCTACACTGTTTGGGG - Intronic
1048963671 8:139599875-139599897 GATTCCCCCTACAATGAGTCAGG + Intergenic
1060106914 9:120878353-120878375 CCTTCCCCCAAGAGTGAGTCTGG - Intronic
1061631935 9:131877677-131877699 CCGTCACCCTCCTCTGAGTCAGG - Intronic
1062317663 9:135976423-135976445 CCTTCCCCCTCCCCAGGGTCAGG - Intergenic
1062360515 9:136185868-136185890 CCCTCCTCCTACCCTGAGGCAGG - Intergenic
1185820668 X:3200738-3200760 GCTTCCCTCTCCACTGAGTGTGG + Intergenic
1190911068 X:54773326-54773348 CCCTCCCCCTACACTGGGGCTGG + Intronic
1194330692 X:92580461-92580483 CCATCCCTCTTCACTGAGTCGGG - Intronic
1197761684 X:130032530-130032552 CCTTCCTCCTACAGTGAGTAGGG - Intronic
1199989436 X:152977490-152977512 ACTTCCCACAACACTTAGTCAGG + Intergenic
1200639397 Y:5699531-5699553 CCATCCCTCTTCACTGAGTCGGG - Intronic