ID: 1103942749

View in Genome Browser
Species Human (GRCh38)
Location 12:124509874-124509896
Sequence GAGGCTCAGGTTACTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 425}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103942749_1103942763 17 Left 1103942749 12:124509874-124509896 CCCCCCACAGTAACCTGAGCCTC 0: 1
1: 0
2: 3
3: 30
4: 425
Right 1103942763 12:124509914-124509936 AGGAACATCACGATCTCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 89
1103942749_1103942757 -6 Left 1103942749 12:124509874-124509896 CCCCCCACAGTAACCTGAGCCTC 0: 1
1: 0
2: 3
3: 30
4: 425
Right 1103942757 12:124509891-124509913 AGCCTCCGGACCTCGGTTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1103942749_1103942764 20 Left 1103942749 12:124509874-124509896 CCCCCCACAGTAACCTGAGCCTC 0: 1
1: 0
2: 3
3: 30
4: 425
Right 1103942764 12:124509917-124509939 AACATCACGATCTCTCTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 67
1103942749_1103942759 -3 Left 1103942749 12:124509874-124509896 CCCCCCACAGTAACCTGAGCCTC 0: 1
1: 0
2: 3
3: 30
4: 425
Right 1103942759 12:124509894-124509916 CTCCGGACCTCGGTTTCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1103942749_1103942765 21 Left 1103942749 12:124509874-124509896 CCCCCCACAGTAACCTGAGCCTC 0: 1
1: 0
2: 3
3: 30
4: 425
Right 1103942765 12:124509918-124509940 ACATCACGATCTCTCTTGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103942749 Original CRISPR GAGGCTCAGGTTACTGTGGG GGG (reversed) Intronic
900564948 1:3327638-3327660 GAGGCGGAGGTTACAGTGGCAGG + Intronic
901173293 1:7279834-7279856 CAGCCTCAGGTTACTGCTGGTGG + Intronic
901231966 1:7646456-7646478 GAGGCCCTGGTGACTGAGGGTGG + Intronic
901232017 1:7646648-7646670 GAGGCCCTGGTGACTGAGGGTGG + Intronic
901691515 1:10976420-10976442 GAGGCGGAGGTTGCAGTGGGCGG - Intronic
902029261 1:13409797-13409819 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
902969748 1:20038665-20038687 GATGCTCAGGAGACTGAGGGAGG + Intronic
903172092 1:21560748-21560770 GAGGCCCAGGGGCCTGTGGGAGG + Intronic
903437699 1:23364306-23364328 GAGGCAGAGGTTACAGTGAGCGG - Intronic
903605336 1:24571402-24571424 GAGGCAGAGGTTGCTGTGAGTGG + Intronic
904322839 1:29707995-29708017 GGGGAGAAGGTTACTGTGGGTGG - Intergenic
904754616 1:32761250-32761272 GAGTCTCAGGTGACTGGGAGGGG - Intronic
904788524 1:33000175-33000197 GAGGCGCAGGTTGCAGTGAGTGG + Intergenic
905097831 1:35489735-35489757 GAGGCAGAGGTTACAGTGAGTGG - Intronic
905577403 1:39056276-39056298 GAGGCACAGGTTGCCGTGAGCGG + Intergenic
905642683 1:39602152-39602174 GAGGCAGAGGTTACAGTGAGAGG + Intergenic
907186041 1:52609853-52609875 GAGGCAGAGGTTGCTGTGAGCGG + Intergenic
909516354 1:76511490-76511512 TGTGCTCAGGTCACTGTGGGAGG - Intronic
910000838 1:82340387-82340409 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
911479670 1:98422248-98422270 GAGGCTGGGGTTACTGTGCCTGG + Intergenic
913226658 1:116706479-116706501 GGAGCTCAGGTTCCTGTGGAGGG + Exonic
915107023 1:153541093-153541115 GAGGCTGAGGTTTTTGTGGTGGG - Intronic
915311920 1:155009301-155009323 GGGGCTCAGGTTTCTGCTGGCGG + Intronic
915353213 1:155239458-155239480 GAGGCAGAGGTTGCTGTGAGGGG + Intronic
915498013 1:156294855-156294877 GACGCTCAGGGTGCTGTGGGGGG + Exonic
916215480 1:162389858-162389880 CAGGCTCAGGATAAAGTGGGGGG - Intergenic
916896615 1:169170171-169170193 GAGACTGAGATTACTGTGGGTGG + Intronic
918216360 1:182394918-182394940 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
918499972 1:185183359-185183381 GAGGCACAGGTTGCAGTGAGTGG - Intronic
919042350 1:192406966-192406988 GAGGCTCTATCTACTGTGGGTGG + Intergenic
919636633 1:200009739-200009761 GAGGCTGAGGTTGCCGTGAGCGG - Intergenic
919741472 1:200983779-200983801 TTGGCTCAGGCTGCTGTGGGGGG - Intronic
920277301 1:204816040-204816062 GAGGCGGAGGTTACAGTGAGCGG + Intergenic
920861461 1:209711317-209711339 GTGCCTCAGGTTATTGGGGGTGG + Intronic
923985656 1:239378774-239378796 GAGGCGGAGGTTGCAGTGGGCGG + Intergenic
924353072 1:243137702-243137724 GAGGCAGAGGTTGCAGTGGGCGG + Intronic
924362921 1:243259746-243259768 GAGGCGCAGGTTGCGGTGGGCGG + Intronic
924543104 1:244999887-244999909 GAGGCAGAGGTTGCAGTGGGCGG - Intronic
924721076 1:246623689-246623711 GAGGCGGAGGTTGCAGTGGGCGG + Intronic
1063017667 10:2094767-2094789 GAGGCTCTGGTTACGGTGCCTGG + Intergenic
1065772118 10:29087275-29087297 GAGGCAGAGGTTGCAGTGGGTGG + Intergenic
1066066888 10:31768061-31768083 GAGGCAGAGGTTGCAGTGGGCGG + Intergenic
1067349065 10:45459290-45459312 GAGGCTCAGGCTTCTGGGGAAGG + Intronic
1069054078 10:63826290-63826312 GAGGCTGAGGTTGCTGTGAGCGG + Intergenic
1069575504 10:69524849-69524871 GAGGCAGAGGTTGCTGTGAGTGG - Intergenic
1069964482 10:72102902-72102924 GAGGCACAGGTTGCAGTGAGCGG + Exonic
1070319890 10:75346730-75346752 GAGGCTGAGGTTGCTGGGTGTGG - Intergenic
1070672453 10:78387699-78387721 GAGGTTCAGGGCACTATGGGTGG + Intergenic
1071840047 10:89460672-89460694 GAGGCGGAGGTTACAGTGAGTGG + Intronic
1073247502 10:102101988-102102010 GAGGTGGAGGTTACTGTGAGCGG - Intergenic
1073444854 10:103574556-103574578 GAGGCTGAGGTCAGTGGGGGAGG + Intronic
1074670388 10:115783940-115783962 GAGGCTGAGGTTGCAGTGAGTGG + Intronic
1075188634 10:120285992-120286014 GAGGCCTAGGTCACTGTGGTAGG - Intergenic
1075697797 10:124448958-124448980 GAGGCTCAGGTCATCGGGGGAGG - Intronic
1076232376 10:128832289-128832311 GAGGCACAGGTTGCAGTGAGCGG + Intergenic
1077099237 11:814211-814233 GAGGCGCAGGTTGCAGTGAGTGG - Intergenic
1077148218 11:1055368-1055390 GAGGCTCAGGAGACTGGGGTGGG - Intergenic
1077151357 11:1074470-1074492 CAGGCTCACGTTACGCTGGGAGG - Intergenic
1079397606 11:20079109-20079131 GAGGCAGAGGTTACAGTGAGCGG - Intronic
1079818590 11:25094719-25094741 GAGGCCCAGGGTGCTGAGGGTGG + Intergenic
1080857966 11:36128776-36128798 GAGGCTGAGGTTGCAGTGAGTGG + Intronic
1081044158 11:38250849-38250871 GATGCTCAGGGTGCTGAGGGTGG - Intergenic
1082660750 11:55907974-55907996 GTGTCTCTGGTCACTGTGGGGGG + Intergenic
1082726955 11:56747743-56747765 GAGGCAGAGGTTGCTGTGAGTGG - Intergenic
1083328251 11:61884661-61884683 GAGCCTCAGGGAACTGTGGGAGG + Intronic
1083401930 11:62429533-62429555 GTGGCTCAAGCCACTGTGGGAGG + Intergenic
1083585369 11:63854268-63854290 GAGGCAGAGGTTGCAGTGGGCGG - Intronic
1084020080 11:66412075-66412097 GAGGCTGAGGTATCTGTTGGTGG + Intergenic
1084780958 11:71407881-71407903 GGGGCCCAGGGTAGTGTGGGTGG + Intergenic
1086466582 11:87060040-87060062 GAGGTGTAGGTTGCTGTGGGCGG + Intronic
1086554657 11:88094684-88094706 CAGGCTCAGGTTAAAGTAGGTGG - Intergenic
1087491203 11:98829215-98829237 GAGGGCCAGTTTACAGTGGGTGG + Intergenic
1087843242 11:102941866-102941888 GATGCTTTGGTTACTGTGGAAGG + Intergenic
1089703546 11:120260362-120260384 GGAGCTCAGGTCACTGTTGGTGG + Intronic
1089710181 11:120308866-120308888 GAGGCGCAGGTTGCAGTGAGCGG + Intronic
1089897559 11:121946883-121946905 GAGGGTCAGTTTCCTGAGGGAGG + Intergenic
1090120251 11:124019440-124019462 GAGGCCAAGGTTACAGTGAGTGG - Intergenic
1092383565 12:8018409-8018431 GAGGCGGAGGTTGCAGTGGGCGG + Intergenic
1092397669 12:8142602-8142624 GAGGCTCTGGTGGCTGAGGGTGG - Intronic
1092573856 12:9757007-9757029 GAGGCAGAGGTTGCTGTGAGCGG + Intronic
1092813362 12:12291732-12291754 GAGGCTGAGGTTGCAGTGAGTGG + Intergenic
1093214476 12:16347499-16347521 CAGGCGATGGTTACTGTGGGCGG + Intronic
1094260059 12:28485227-28485249 GAGGCAGAGGTTACAGTGAGCGG - Intronic
1095478185 12:42607596-42607618 GAGGCTCATATTACTGTCAGAGG + Intergenic
1096332057 12:50722322-50722344 GAGGCGGAGGTTGCAGTGGGTGG - Intronic
1096378312 12:51133373-51133395 GAGGCTGAGGCTACAGTGAGTGG - Intronic
1096699446 12:53372425-53372447 GAGGCTCAGGGAACTGAGGAGGG - Intergenic
1096841346 12:54381123-54381145 GAGGCTGAGGTTGCAGTGAGCGG + Intronic
1097062671 12:56297631-56297653 GAGGCAGAGGTTACAGTGAGCGG + Intronic
1098277559 12:68828463-68828485 GAGGCTGAGGTTGAGGTGGGAGG + Intronic
1099013602 12:77320615-77320637 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1099207006 12:79740075-79740097 GTGGCTCAGGCCACTTTGGGAGG - Intergenic
1099269009 12:80484074-80484096 GAGGCGGAGGTTACAGTGAGTGG - Intronic
1099602213 12:84754845-84754867 GAGGCTGAGATTACAGTGAGTGG + Intergenic
1099952516 12:89320351-89320373 GAGGCGGAGGTTGCTGTGAGCGG - Intergenic
1102232714 12:111274699-111274721 GAGGCTCAGGCTATTGATGGTGG - Intronic
1102304926 12:111797528-111797550 GAGGCAGAGGTTACAGTGAGTGG + Intronic
1102334398 12:112065426-112065448 GAGGCAGAGGTTACAGTGAGTGG + Intronic
1102335208 12:112072864-112072886 GAGGCAGAGATTACAGTGGGAGG + Intronic
1102707554 12:114895486-114895508 TAGGCTCAGCTAACTGTGGTCGG + Intergenic
1103116947 12:118342861-118342883 GAGGCCAAGGTTACAGTGAGTGG + Intronic
1103432375 12:120899820-120899842 GAGGCGGAGGTTGCTGTGAGCGG + Intronic
1103441854 12:120968898-120968920 AAGGCTCACATTGCTGTGGGTGG + Intergenic
1103542759 12:121677779-121677801 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1103717567 12:122954277-122954299 GAGGCAGAGGTTGCTGTGAGTGG - Intronic
1103816771 12:123664403-123664425 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
1103942749 12:124509874-124509896 GAGGCTCAGGTTACTGTGGGGGG - Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1106038164 13:26064331-26064353 GAGGCAGAGGTTGCTGTGAGTGG + Intergenic
1106314434 13:28580661-28580683 GAGGCGAAGGTTACAGTGAGCGG - Intergenic
1106951192 13:34885618-34885640 GAGGCAGAGGTTACAGTGAGTGG + Intergenic
1107267861 13:38579076-38579098 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
1107337253 13:39368258-39368280 GAGGCAAAGGTTGCAGTGGGCGG + Intronic
1109454946 13:62573462-62573484 GAGGCGGAGGTTGCAGTGGGTGG + Intergenic
1109601645 13:64638923-64638945 GAGGCTGAGGTTGCAGTGAGCGG - Intergenic
1109644701 13:65237829-65237851 GAGGCAGAGGTTGCTGTGAGTGG + Intergenic
1110123128 13:71907794-71907816 GAGGCGCAGCTTGCAGTGGGCGG + Intergenic
1111488696 13:88940930-88940952 GAGGCGGAGGTTGCTGTGAGTGG - Intergenic
1113365090 13:109668637-109668659 GAGGCTCAGGTAACTGAGCGAGG - Intergenic
1114690952 14:24580657-24580679 GAGGCTGAGGTTGCTGTAAGTGG + Intergenic
1115298785 14:31860230-31860252 GAGGCTGAGGTTGCAGTGAGTGG + Exonic
1115837792 14:37428515-37428537 GAGGCAGAGGTTGCCGTGGGTGG + Intronic
1115961956 14:38844144-38844166 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
1116815950 14:49584050-49584072 GAGGCTGAGGTTGCAGTGAGTGG - Intronic
1118353765 14:64993924-64993946 GAGGCGGAGGTTACGGTGAGTGG - Intronic
1119527151 14:75331911-75331933 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1119896926 14:78228225-78228247 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
1120193215 14:81458435-81458457 GAGGTAGAGGTTGCTGTGGGCGG + Intergenic
1121345299 14:93131298-93131320 GAGGCTCATGTAAGTCTGGGAGG - Intergenic
1121715028 14:96067626-96067648 GAGGCAGAGGTTGCTGTGAGCGG + Intronic
1121830856 14:97050877-97050899 GAGTCTCAGGATACTGGGGAGGG + Intergenic
1122559559 14:102602472-102602494 GAGGCGGAGGTTACAGTGAGAGG - Intronic
1122681698 14:103469554-103469576 GAGGCTGAGGTTGCAGTGAGCGG - Intronic
1123520636 15:21069279-21069301 GAGGCTGAGGTTGCAGTGAGCGG + Intergenic
1124088683 15:26577440-26577462 GAGGCAGAGGTTGCTGTGAGAGG + Intronic
1124490635 15:30152869-30152891 GAGGTTCAGGCTACAGTGAGTGG - Intergenic
1124752898 15:32385460-32385482 GAGGTTCAGGCTACAGTGAGTGG + Intergenic
1125436677 15:39653103-39653125 GAGGCAGAGGTTACAGTGAGTGG + Intronic
1125472753 15:40020616-40020638 GAGGCGGAGGTTACAGTGAGCGG + Intronic
1125619048 15:41042542-41042564 GAGGCTGAGGTTACAGTGAGTGG - Intronic
1125630707 15:41144651-41144673 GAGGCGGAGGTTGCAGTGGGCGG + Intergenic
1127012292 15:54643703-54643725 GAGTCTCTGGGTCCTGTGGGAGG + Intergenic
1128956665 15:71954269-71954291 GAGGCGGAGGTTACAGTGAGCGG - Intronic
1129003416 15:72352732-72352754 GAGGCAGAGGTTGCAGTGGGTGG - Intronic
1129948060 15:79559457-79559479 ATGGCTCAGGGAACTGTGGGAGG - Intergenic
1130052643 15:80496636-80496658 GTGGCCCAGGTTACTAGGGGAGG + Intronic
1130561705 15:84964079-84964101 GAGAATCAGGGTGCTGTGGGAGG - Intergenic
1131258320 15:90875749-90875771 GAGGCCCTGGTTGCTATGGGTGG + Exonic
1131421789 15:92312469-92312491 GTTGCTCAGGTTACTGCTGGAGG + Intergenic
1131801536 15:96074509-96074531 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
1133296491 16:4755385-4755407 GAGGCAGAGGTTACAGTGAGCGG - Intronic
1134405629 16:13956184-13956206 GAGGCTGAGGTTGCGGTGAGCGG + Intergenic
1134806972 16:17134403-17134425 GAGGCTCAGGGTACAGAGTGGGG - Intronic
1135769533 16:25206712-25206734 GAGGCGCAGGTTGCAGTGAGCGG - Intergenic
1136423414 16:30152112-30152134 GAGGCGGAGGTTAGTGTGAGCGG - Intergenic
1137514508 16:49131301-49131323 GAGGCTGAGGTTGCAGTGAGTGG + Intergenic
1137573226 16:49580011-49580033 GAAGCTCAGGGTCCCGTGGGTGG - Intronic
1137657140 16:50170120-50170142 GAGGCTGAGGTTGCAGTGAGCGG - Intronic
1139262824 16:65611310-65611332 GAGGCGGAGGTTACAGTGAGCGG + Intergenic
1139728370 16:68921030-68921052 GAGGCGGAGGTTGCAGTGGGCGG + Intronic
1140268883 16:73445062-73445084 GAGGCGGAGGTTACAGTGAGCGG + Intergenic
1140517949 16:75557758-75557780 GAGGCACAGATTACAGTGAGCGG + Intergenic
1141074453 16:80990825-80990847 GAGGCTGAGGTTGAGGTGGGAGG - Intronic
1141457841 16:84156032-84156054 GAGGCAGAGGTTGCAGTGGGCGG - Intronic
1142409656 16:89909438-89909460 GAGGCACAGGTTGCAGTGAGTGG + Intronic
1142816964 17:2434283-2434305 AAGGCGGAGGTTACAGTGGGCGG - Intronic
1144730138 17:17521299-17521321 GATTCTCAGGGTACTGTGGGAGG + Intronic
1145368320 17:22285054-22285076 GAGGCAAAGGTTACAGTGAGTGG - Intergenic
1145828886 17:27898857-27898879 GAGGCGGAGGTTGCAGTGGGTGG + Intergenic
1146612439 17:34319667-34319689 AAGGCTCAGGTCACTGAGGCTGG + Intronic
1146926697 17:36750531-36750553 TAGGCTCAGTCTACGGTGGGTGG - Intergenic
1147025763 17:37581833-37581855 GAGGCAGAGGTTGCTGTGAGCGG - Intronic
1147998489 17:44374645-44374667 GAAGCTCAGGTGAGTGTGGGGGG - Exonic
1148051444 17:44771923-44771945 GAGGCTGGGGTTACTGAGGGAGG - Intronic
1149707724 17:58710425-58710447 GAGGCGGAGGTTACAGTGGGTGG + Intronic
1150055906 17:62015642-62015664 GAGGCAGAGGTTACAGTGAGCGG - Intronic
1150372331 17:64650757-64650779 GAGGCTGAGGTTGCAGTGAGTGG + Intronic
1150502859 17:65667965-65667987 GAGGCTGAGGTTGCAGTGAGTGG - Intronic
1150773876 17:68063813-68063835 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
1151211916 17:72550757-72550779 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
1152327416 17:79649633-79649655 GAGGCGGAGGTTGCAGTGGGCGG + Intergenic
1152618684 17:81350013-81350035 AAGGCTCAGGTTGCGGGGGGAGG + Intergenic
1152889359 17:82871693-82871715 CAGGCTCAGGCTACTGTGCTGGG + Intronic
1152941280 17:83173962-83173984 GGGGGTCAGGCTGCTGTGGGGGG + Intergenic
1152946774 17:83202208-83202230 GAGGGTCAGGTTACACTGGGAGG - Intergenic
1153666286 18:7370030-7370052 GGGGCTCAGGATACTGAGGATGG + Intergenic
1154142071 18:11833100-11833122 GAGGCTGAGGTTGCAGTGAGTGG - Intronic
1154485301 18:14867618-14867640 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1155556695 18:27027984-27028006 GAGGCAGAGGTTGCAGTGGGAGG - Intronic
1155964155 18:32020116-32020138 GAGGCGGAGGTTGCAGTGGGCGG - Intronic
1156320334 18:36015281-36015303 GAGGCTGAGGTTGCAGTGAGCGG - Intronic
1156584520 18:38417133-38417155 GAGGCACAGGTTGCAGTGAGAGG - Intergenic
1156757776 18:40549642-40549664 GAGGCACAGGTTGCAGTGAGCGG - Intergenic
1157608240 18:48939666-48939688 GGGGCTCAGTTTAGGGTGGGAGG - Intronic
1159385385 18:67718143-67718165 GAGGCAGAGGTTGCTGTGAGTGG + Intergenic
1159959972 18:74547700-74547722 GAAGCTCAGGCAGCTGTGGGAGG + Intronic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1160727859 19:625473-625495 GAGGTTCACGTTCCTCTGGGAGG + Intronic
1161013209 19:1970008-1970030 GAGGCTCCGGTGACTCGGGGCGG - Intronic
1161414158 19:4135454-4135476 GAGGCGGAGGTTACAGTGAGCGG + Intergenic
1161427616 19:4212562-4212584 GAGGCTCAGCTGCCTCTGGGAGG - Intronic
1162177270 19:8840270-8840292 GAGGCTCAGATCACTCTTGGTGG + Intronic
1162197721 19:8998538-8998560 GAGGCGGAGGTTGCTGTGAGCGG + Intergenic
1162358218 19:10200623-10200645 GAGGCTGAGGTTACAGTGAATGG - Intronic
1162486336 19:10962611-10962633 GAGGCGGAGGTTACAGTGAGCGG - Intronic
1162514179 19:11138373-11138395 GAGGCTCGGGTCACTGTGGCTGG + Intronic
1162599404 19:11656186-11656208 GAGGCGGAGGTTACAGTGAGTGG + Intergenic
1162948677 19:14058035-14058057 GAGGCGCAGGTTGCAGTGAGCGG + Intronic
1163186320 19:15641678-15641700 GAGGCTCAGGTGAGAGGGGGTGG + Intronic
1163286140 19:16349173-16349195 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
1164269412 19:23657644-23657666 GAGGCAGAGGTTGCAGTGGGCGG + Intronic
1164803006 19:31093252-31093274 GAGGGTCAGGTGACTGATGGGGG + Intergenic
1165350375 19:35271942-35271964 GTGGGTCAGGTTACTTTGTGGGG + Intronic
1165882130 19:39051742-39051764 GAGGCAGAGGTTGCAGTGGGTGG + Intergenic
1165906610 19:39198127-39198149 GAGGGCCAGGTTGCTGAGGGTGG + Intronic
1166368735 19:42290289-42290311 GGGGCTCAGGGTCCAGTGGGGGG - Exonic
1166672163 19:44717234-44717256 GAGGCAGAGGTTTCTGTGAGCGG + Intergenic
1166759648 19:45216506-45216528 GAGGCAGAGGTTACAGTGAGCGG + Intronic
1166980427 19:46628895-46628917 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1167217391 19:48173705-48173727 GAGGCTGAGGTTGCAGTGAGTGG - Intronic
1167753214 19:51393651-51393673 GAGGCGGAGGTTGCAGTGGGCGG - Intergenic
1167878348 19:52433166-52433188 GAGGCAGAGGTTGCAGTGGGTGG + Intronic
1168336014 19:55598193-55598215 GAGGCTTAAATTACAGTGGGAGG - Intronic
1168650282 19:58088113-58088135 GAGGCTCTGGGCACTGTGGGTGG - Intronic
1168655882 19:58127429-58127451 GAGGCAGAGGTTGCTGTGAGTGG + Exonic
925390539 2:3491065-3491087 GCGGCTGAGGTGGCTGTGGGTGG - Intergenic
925818017 2:7772182-7772204 GGGGCTCATGTCAGTGTGGGTGG - Intergenic
926042556 2:9685484-9685506 CAGGCGCAGGTTACGGTGAGTGG + Intergenic
926255975 2:11199385-11199407 GAGGCTGAGGCTACAGTGAGTGG - Intronic
926281496 2:11451419-11451441 GAGGCCGAGGTTGCTGTGAGCGG - Intronic
928592157 2:32828162-32828184 GAGGCGGAGGTTACGGTGAGTGG - Intergenic
928754101 2:34503280-34503302 GGGGCTGAGGTTGCAGTGGGTGG - Intergenic
929933534 2:46276833-46276855 GAGGCTCAAGTGTCTGAGGGAGG - Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
930572921 2:53109718-53109740 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
930763856 2:55063808-55063830 GAGGCAGAGGTTACAGTGAGCGG + Intronic
932142080 2:69288126-69288148 GAGGCTGAGGTTGCAGTGAGCGG + Intergenic
932491318 2:72124098-72124120 AAGTCTAAGGTTATTGTGGGTGG - Intergenic
933774503 2:85764097-85764119 GAAGCTGAGGTTGCTGTGGTCGG - Exonic
934496664 2:94807958-94807980 GTGGCTCATGTCACTTTGGGAGG + Intergenic
934520112 2:95014755-95014777 GAGGCTCATGTTAGGGTGAGGGG + Intergenic
934930226 2:98416052-98416074 GAGGCGGAGGTTGCAGTGGGTGG + Intergenic
935462886 2:103360254-103360276 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
937252318 2:120532817-120532839 GAGGCTCGGGCTACTGTGCATGG - Intergenic
939819417 2:146938169-146938191 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
941074111 2:160987866-160987888 GAGGCAGAGGTTGCAGTGGGCGG + Intergenic
941376600 2:164739089-164739111 GAGGCTCTGCTTACATTGGGCGG - Intronic
943091965 2:183386088-183386110 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
943710568 2:191090629-191090651 GAGGCAGAGGTTGCAGTGGGCGG - Intronic
944210231 2:197199114-197199136 GAGGCTCTGGTTTCTGTGGTGGG - Intronic
945259112 2:207827863-207827885 GAGGCTGAGGTAACTGAGGCAGG - Intergenic
945272872 2:207959388-207959410 GAGGTTCAGATTATTTTGGGGGG + Intronic
947504988 2:230701607-230701629 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
947878424 2:233483418-233483440 GAGGCAGAGGTTACAGTGAGTGG + Intronic
948768171 2:240233867-240233889 GAGGATCAGGGTGCTGTGGGCGG - Intergenic
948844591 2:240677018-240677040 GTGGCTCAGGACAATGTGGGGGG - Intronic
948849269 2:240697861-240697883 GTGGCTCAGGACAATGTGGGGGG + Intronic
948937741 2:241178691-241178713 GAGGCGGAGGTTACAGTGAGCGG - Intronic
1169563007 20:6822455-6822477 GAGGCGGAGGTTACAGTGAGTGG - Intergenic
1170336401 20:15275036-15275058 GAGGCTGGGGTGACTGGGGGTGG + Intronic
1170713981 20:18816705-18816727 GAGGCGGAGGTTACAGTGAGCGG - Intronic
1171036987 20:21721960-21721982 GAGGCTGAGGTCAAGGTGGGAGG - Intergenic
1171432088 20:25089389-25089411 GGGGCTCAGGGTCCTCTGGGGGG - Intergenic
1171887963 20:30674693-30674715 GTGGCTCACGTCACTTTGGGAGG + Intergenic
1172156551 20:32829758-32829780 AAGGCTCAGCTCACTGTTGGGGG - Intronic
1172960508 20:38795828-38795850 GCGGCACAGGTTGCTGAGGGGGG + Intergenic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1176071346 20:63228146-63228168 GAGGCTGAGGTTTCAGTGGGCGG - Intergenic
1176723942 21:10414526-10414548 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1176796033 21:13371858-13371880 GGGGCTCAGGGTCCTGTGGGTGG - Intergenic
1176984533 21:15420781-15420803 TGGGCTCAGGTCACTGAGGGAGG + Intergenic
1177073923 21:16548559-16548581 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1179208382 21:39305028-39305050 GAGGCGGAGGTTACAGTGAGCGG - Intronic
1180305188 22:11067700-11067722 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1181319172 22:21991469-21991491 GAGGCTCAGGGAACTGAGGTGGG + Intergenic
1181438571 22:22924156-22924178 CAGGCCTGGGTTACTGTGGGTGG + Intergenic
1181799851 22:25338729-25338751 GAGGCTGAGGTTGCAGTGAGTGG - Intergenic
1182077799 22:27506714-27506736 GATGCACAGGTTACTGTGGAAGG + Intergenic
1182279054 22:29207690-29207712 GATGCTCAGGCTACTGTGATAGG - Intronic
1182620780 22:31617324-31617346 GAGGCTCTGCTTCCTATGGGGGG + Intronic
1182895088 22:33852783-33852805 GAGGCGGAGGTTACAGTGAGTGG + Intronic
1184004520 22:41698482-41698504 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
1184269732 22:43372443-43372465 GAGGCGGAGGTTACAGTGAGTGG + Intergenic
1185402195 22:50625068-50625090 GAGGCTCAGGTGTCTGGAGGGGG - Exonic
950365493 3:12480599-12480621 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
952105203 3:30061951-30061973 GAGGCTGAGCTTGCAGTGGGCGG - Intergenic
952553636 3:34507188-34507210 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
952668245 3:35934578-35934600 GAAGCTCATGTTCCTGTGGATGG + Intergenic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
954065820 3:48105153-48105175 GAGGCAGAGGTTGCAGTGGGTGG - Intergenic
954172838 3:48819084-48819106 GAGGCGGAGGTTGCAGTGGGAGG - Intronic
954252572 3:49379582-49379604 GAGGCTAAGGTTGCAGTGAGTGG - Intronic
954453784 3:50586066-50586088 GAAGCTCTGGTAGCTGTGGGAGG + Intergenic
955732384 3:62000208-62000230 GAAGCTGAGGTTGCAGTGGGCGG + Intronic
957005538 3:74942014-74942036 GAGGCCCAGGTTGCAGTGAGCGG - Intergenic
959073123 3:101721959-101721981 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
963804406 3:149709044-149709066 GAGGCAGAGGTTGCAGTGGGTGG - Intronic
964058270 3:152488489-152488511 GAGTCTCAGGTGACTATGGCAGG + Intergenic
964276037 3:155009842-155009864 GAGGCGGAGGTTACAGTGAGCGG + Intergenic
966816570 3:183894841-183894863 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
967082080 3:186058940-186058962 GAGGCGGAGGTTACAGTGGGTGG + Intronic
967525946 3:190492864-190492886 GAGGCTGGGGTGAGTGTGGGGGG + Intergenic
968489103 4:880691-880713 GAGAGTCAGGTGCCTGTGGGAGG - Intronic
969271744 4:6107894-6107916 GAAGATGAGGTGACTGTGGGTGG + Intronic
969318074 4:6394058-6394080 GAAGCCCAGGTGACTGGGGGTGG - Intronic
971214182 4:24648298-24648320 GAGCCCCAGATTACTCTGGGCGG + Intergenic
971322788 4:25618725-25618747 GAGGCTGAGGTTGCAGTGAGTGG + Intergenic
972434067 4:39014685-39014707 GAGGCTGAGGTTGCAGTGAGCGG + Intronic
974362230 4:60896635-60896657 GAGGCTAAGGTTTCAGTGAGAGG - Intergenic
974705472 4:65510103-65510125 GAGGCAGAGGTTGCAGTGGGGGG - Intronic
975631710 4:76410588-76410610 CAGTCTCAGGTTTCTGTGGAAGG - Intronic
977549300 4:98423613-98423635 GAGGCGGAGGTTACAGTGAGTGG - Intronic
977658920 4:99561035-99561057 GAGGCGGAGGTTGCAGTGGGCGG - Intronic
979248874 4:118542825-118542847 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
979889756 4:126076459-126076481 GAGGCGCAGGTTGCAGTGAGCGG + Intergenic
980525204 4:133981088-133981110 GAGGCTGAGGTTGCAGTGAGTGG + Intergenic
981484583 4:145271775-145271797 GAGGCAGAGGTTACAGTGAGGGG - Intergenic
981561243 4:146050548-146050570 GAGGCTGAGGTTGCAGTGAGTGG + Intergenic
981709666 4:147696603-147696625 GAGGCAGAGGTTACAGTGAGAGG + Intergenic
981906711 4:149929620-149929642 GAGGCGGAGGTTGCAGTGGGTGG - Intergenic
982011586 4:151110813-151110835 GAGGCAGAGGTTGCAGTGGGTGG + Intronic
984522317 4:180816741-180816763 GTGCTTCAGGGTACTGTGGGAGG - Intergenic
984732329 4:183079493-183079515 GAGGCGAAGGTTGCAGTGGGTGG - Intergenic
985248343 4:187998263-187998285 GAGGCGGAGGTTGCTGTGAGCGG + Intronic
985471987 5:52413-52435 GAGGCACAGGTTGCAGTGAGTGG + Intergenic
985854472 5:2414075-2414097 GAGGCTGAGGTTACAGTGAGTGG - Intergenic
986016704 5:3763841-3763863 GAGGCGGAGGTTGCTGTGAGTGG + Intergenic
988121243 5:26965503-26965525 GAGGCAGAGGTTACAGTGAGTGG + Intronic
988231137 5:28481401-28481423 GAGGCTGAGGTTGCGGTGAGCGG - Intergenic
989377827 5:40783686-40783708 GAGGCGGAGGTTACAGTGAGCGG + Intronic
991332630 5:65508713-65508735 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
991943746 5:71880320-71880342 GAGGGGCTGGTTACTGTGAGTGG + Intergenic
995097370 5:108253920-108253942 GAGGCTGAGGTTGCAGTGAGTGG + Intronic
995517376 5:112967530-112967552 GAGGCGGAGGTTACAGTGAGCGG + Intergenic
996086529 5:119310754-119310776 GAGGCGGAGGTTACAGTGAGTGG + Intronic
996147695 5:119995933-119995955 GTGGCTCACGCCACTGTGGGAGG - Intergenic
996308871 5:122080086-122080108 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
998368083 5:141644089-141644111 GAGGCCCAGGCCACTGTAGGAGG + Intronic
1002090492 5:176802766-176802788 GAGGCCCAGGTTTGTGTGTGGGG - Intergenic
1002381225 5:178831453-178831475 GGGGCTCAGGGCCCTGTGGGTGG - Intergenic
1002724084 5:181283057-181283079 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1002833669 6:847128-847150 GAGGATCAAGCTCCTGTGGGCGG + Intergenic
1003756825 6:9130631-9130653 GAGGCGGAGGTTACAGTGAGTGG + Intergenic
1003928973 6:10904896-10904918 GAGGCTGAGGCTAAGGTGGGCGG + Intronic
1004182524 6:13393283-13393305 GAGGCAGAGGTTGCAGTGGGTGG + Intronic
1004353041 6:14907706-14907728 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1005038494 6:21579866-21579888 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1005776219 6:29134105-29134127 GAGGCACAGGTTAAAGTGAGTGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1009987058 6:70793803-70793825 GAGGCGGAGGTTGCAGTGGGAGG - Intronic
1011096744 6:83674361-83674383 GAGGCAGAGGTTGCTGTGAGTGG + Intronic
1013078890 6:106795158-106795180 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
1013241729 6:108252708-108252730 GAGGCAGAGGTTGCGGTGGGTGG - Intronic
1014158699 6:118141545-118141567 GATGGTCAGGTTCCTGTGAGGGG + Intronic
1014384679 6:120785961-120785983 GAGGCTGGGGGTACTGAGGGTGG + Intergenic
1014930736 6:127332861-127332883 GAGGCTGAGGTTTCAGTGAGTGG - Intronic
1016527344 6:145016912-145016934 GAGGATCAGTTTCCTGAGGGAGG + Intergenic
1016921254 6:149296275-149296297 AAGTCTCAGCTTACTGTGAGAGG + Intronic
1017511649 6:155119408-155119430 GAGGCAGAGGTTACAGTGAGTGG - Intronic
1017833965 6:158159693-158159715 GAGGCAGAGGTTGCAGTGGGTGG - Intronic
1020034784 7:4958455-4958477 GAGGCTCGGGGTGCGGTGGGGGG - Intronic
1020235779 7:6354246-6354268 GAGGTGGAGGTTGCTGTGGGCGG + Intergenic
1023233197 7:38055384-38055406 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
1024696915 7:51867193-51867215 GGGGCTCAGGTAGCTGTGGTGGG - Intergenic
1024747439 7:52424761-52424783 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1026355042 7:69550246-69550268 GAGGCTCAGGTTGCTGTCCTGGG + Intergenic
1026859672 7:73777730-73777752 GAGGCGGAGGTTGCAGTGGGCGG - Intergenic
1028861999 7:95662838-95662860 GAATCTCAGCTTAATGTGGGAGG - Intergenic
1030206888 7:106959899-106959921 GAGACTCAGGAGGCTGTGGGTGG - Intergenic
1030925448 7:115448136-115448158 GAGGCGGAGGTTACAGTGAGCGG - Intergenic
1031140479 7:117937039-117937061 GAGGCAGAGGTTGCAGTGGGCGG + Intergenic
1031480136 7:122268391-122268413 GAGGCTCAGCTTAGTGAAGGAGG + Intergenic
1032066419 7:128774929-128774951 GGAGCTCAGGTTGATGTGGGTGG - Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1032387753 7:131536393-131536415 GATGCTGAGGCTTCTGTGGGAGG + Intronic
1033145812 7:138869312-138869334 GAGGGTCACCTTAGTGTGGGAGG - Intronic
1033376499 7:140766651-140766673 GAGGCTGAGGTTGCAGTGAGTGG - Intronic
1034396097 7:150826047-150826069 GAGGCACAGGTTACAGTCTGTGG + Intronic
1034486056 7:151363862-151363884 GAGGCAGAGGTTACAGTGGGCGG - Intronic
1034810787 7:154130003-154130025 GAGGCGGAGGTTGCAGTGGGAGG + Intronic
1034956650 7:155339252-155339274 GAGGCTCTGTTTGCTGTGTGGGG - Intergenic
1035571032 8:672524-672546 CAGGTTCAGGTTAATGTGGTGGG - Intronic
1036449200 8:8850752-8850774 GAGGCGAAGGTTACAGTGAGTGG + Intronic
1036458541 8:8931184-8931206 GAGGCGGAGGTTGCTGTGAGCGG - Intergenic
1037348932 8:17928700-17928722 GAGGCAGAGGTTACAGTGAGCGG - Intronic
1039335115 8:36580646-36580668 GCTGCTCAGGTGACTGTGGCAGG + Intergenic
1039913476 8:41842915-41842937 GAGGCTGAGGTTGCAGTGAGCGG - Intronic
1039958411 8:42224766-42224788 GAGGCAGAGGTTACAGTGAGCGG + Intergenic
1040716014 8:50253350-50253372 GAGGCAGAGGTGACTGTGAGTGG + Intronic
1042259691 8:66845326-66845348 GAGGCGGAGGTTACAGTGAGTGG + Intronic
1043606616 8:82008382-82008404 GAGACTCAGATAACTGTGGTAGG + Intergenic
1043864643 8:85361124-85361146 GAGGCTCAGGCCACTGGGAGGGG + Intronic
1043991858 8:86765303-86765325 TAGGCCAAGGTAACTGTGGGAGG + Intergenic
1044071491 8:87766124-87766146 TAGGCACAGCATACTGTGGGAGG - Intergenic
1044632261 8:94291389-94291411 GAGGCTGAGCTTTCTGTGGTTGG - Intergenic
1044714626 8:95089129-95089151 GAGGCAGAGGTTGCAGTGGGCGG - Intronic
1046739314 8:117811685-117811707 GAGGCAGAGGTTACAGTGAGCGG - Intronic
1046884990 8:119356535-119356557 GATGCCCATGTGACTGTGGGTGG + Intergenic
1048224610 8:132572981-132573003 AAGGCTCAGGTTCTTGTGGGAGG - Intronic
1048490834 8:134892311-134892333 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
1048529822 8:135237217-135237239 GGGGCTCAGGTAACTTTAGGAGG + Intergenic
1049183421 8:141235310-141235332 GAGCGTCAGGTTACCGTGAGGGG + Intronic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1050146268 9:2571260-2571282 GAGGCACTAGTTACTGTTGGCGG - Intergenic
1050625364 9:7498459-7498481 GTGACTCAGGCTACTGTGGATGG - Intergenic
1052660921 9:31431065-31431087 GAGGCGAAGGTTACAGTGAGCGG - Intergenic
1052670330 9:31549069-31549091 CAGGCTCATGTTACCGTGGCTGG - Intergenic
1052739666 9:32381434-32381456 GAGGCTGAGTTTGATGTGGGTGG - Intergenic
1053079178 9:35160492-35160514 GAGGCGCAGGTTGCAGTGAGTGG - Intergenic
1053660488 9:40272489-40272511 GTGGCTCATGTCACTTTGGGAGG - Intronic
1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1053910861 9:42901838-42901860 GTGGCTCATGTCACTTTGGGAGG - Intergenic
1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054372607 9:64418707-64418729 GTGGCTCATGTCACTTTGGGAGG - Intergenic
1054524123 9:66103796-66103818 GTGGCTCATGTCACTTTGGGAGG + Intergenic
1054680235 9:67908482-67908504 GTGGCTCATGTCACTTTGGGAGG - Intergenic
1054820232 9:69514834-69514856 GAGGCAGAGGTTACGGTGAGCGG + Intronic
1055232344 9:74080922-74080944 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
1055959217 9:81804098-81804120 GAGGCTGAGGTTGCAGTGAGCGG - Intergenic
1056531295 9:87490039-87490061 GAGGTTGAGGCTACAGTGGGCGG + Intergenic
1057832494 9:98417968-98417990 GAGGGTGAGGTTGCTGTGGGTGG + Intronic
1058296580 9:103315412-103315434 GAGGCTGAGGTGAGTCTGGGAGG - Intergenic
1058601022 9:106670377-106670399 AAGGCTCAGGATACATTGGGAGG + Intergenic
1058711941 9:107686806-107686828 GAGGCTGAGGTTGCAGTGAGTGG - Intergenic
1058994521 9:110286564-110286586 GAGGCTGAGGTTGCAGTGAGCGG + Intergenic
1060889827 9:127180924-127180946 GAGGCCCAGGCCACAGTGGGGGG - Intronic
1061340007 9:129972600-129972622 GAGGCAGAGGTTGCTGTGAGCGG - Intronic
1061368711 9:130186066-130186088 GAGGCCCTGGGTCCTGTGGGGGG + Intronic
1061546129 9:131305440-131305462 GTGGCTCAGGAGACTGAGGGAGG + Intronic
1062486157 9:136777195-136777217 AAGACTCATGTTAGTGTGGGTGG + Intergenic
1203692869 Un_GL000214v1:62722-62744 GTGGCTCACGTCACTTTGGGAGG + Intergenic
1203557054 Un_KI270744v1:9615-9637 GTGGCTCACGTCACTTTGGGAGG + Intergenic
1203643426 Un_KI270751v1:41469-41491 GTGGCTCACGTCACTTTGGGAGG - Intergenic
1186946955 X:14579398-14579420 GAGGCGCAGGTTGCGGTGAGTGG - Intronic
1187019451 X:15365201-15365223 GAGGCTGAGGTTGCAGTGAGCGG - Intronic
1187127236 X:16465635-16465657 GTGGCTGAAGTGACTGTGGGTGG + Intergenic
1187129362 X:16487482-16487504 GAGGCAGAGGTTGCAGTGGGCGG - Intergenic
1187442188 X:19330287-19330309 GATGGTCAGGTCATTGTGGGTGG - Intergenic
1187508078 X:19893329-19893351 GAGGCAGAGGTTACAGTGAGCGG - Intergenic
1187792198 X:22963131-22963153 GAGGCTCAGCTTACTACGTGGGG + Intergenic
1187910041 X:24103502-24103524 GAGGCGGAGGTTACGGTGAGTGG - Intergenic
1188667535 X:32842876-32842898 GAGGCTGAGGTTGCAGTGAGTGG - Intronic
1188936139 X:36176831-36176853 GAGGCTGAGGTTGCAGTGAGCGG + Intergenic
1189548712 X:42071320-42071342 AAGGCTCAGGGTCCTGTGGCAGG + Intergenic
1190358775 X:49629900-49629922 GAGGCAGAGGTTACAGTGAGTGG - Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1190958140 X:55217674-55217696 GAGGCGGAGGTTACAGTGAGTGG - Intronic
1191253172 X:58268868-58268890 GAGGCTAAGGTTCCCCTGGGAGG - Intergenic
1192174107 X:68875163-68875185 GAGGCCCAGGGTAGGGTGGGAGG + Intergenic
1192252710 X:69426101-69426123 TAGGCTCAGGCTACTGTCCGTGG - Intergenic
1192456690 X:71282249-71282271 GAGGTTAAGGTTAAGGTGGGAGG - Intergenic
1194720344 X:97333633-97333655 GAGGCGGAGGTTACAGTGAGTGG - Intronic
1195081256 X:101373009-101373031 GAGGCAGAGGTTACAGTGAGCGG + Intronic
1196132483 X:112172252-112172274 GAGGCTGAGGGTACAGTGAGTGG + Intergenic
1197888480 X:131242397-131242419 GAGGCTAAGGATATTGTGGGGGG + Intergenic
1199612737 X:149631777-149631799 GTGGCTCAGGTTTCTCCGGGCGG - Exonic
1199682863 X:150239507-150239529 GAGTATCAGGTTACTGGGAGGGG + Intergenic
1201333649 Y:12855312-12855334 GAGGCTGAGGTTGCAGTGAGCGG - Intronic
1201499970 Y:14631135-14631157 GAGGCAGAGGTTGCTGTGAGTGG - Intronic