ID: 1103943921

View in Genome Browser
Species Human (GRCh38)
Location 12:124516056-124516078
Sequence GAGAACCCCCCCGCCTTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103943917_1103943921 4 Left 1103943917 12:124516029-124516051 CCCTGGGGGTGACAAGGGGACAT 0: 1
1: 0
2: 2
3: 7
4: 157
Right 1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 44
1103943906_1103943921 26 Left 1103943906 12:124516007-124516029 CCAACCCAAGTGGACACCAAGGC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 44
1103943907_1103943921 22 Left 1103943907 12:124516011-124516033 CCCAAGTGGACACCAAGGCCCTG 0: 1
1: 0
2: 1
3: 46
4: 407
Right 1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 44
1103943913_1103943921 10 Left 1103943913 12:124516023-124516045 CCAAGGCCCTGGGGGTGACAAGG 0: 1
1: 0
2: 3
3: 32
4: 292
Right 1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 44
1103943908_1103943921 21 Left 1103943908 12:124516012-124516034 CCAAGTGGACACCAAGGCCCTGG 0: 1
1: 0
2: 2
3: 75
4: 347
Right 1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 44
1103943918_1103943921 3 Left 1103943918 12:124516030-124516052 CCTGGGGGTGACAAGGGGACATG 0: 1
1: 1
2: 0
3: 13
4: 180
Right 1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG 0: 1
1: 0
2: 1
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103943921 Original CRISPR GAGAACCCCCCCGCCTTCGG AGG Intronic
900130791 1:1086334-1086356 GAGAACCCCCTGGCTTTCAGGGG - Intronic
900155283 1:1201334-1201356 GAGAACCCGCCCGCCTCCCCCGG + Intergenic
911002515 1:93180634-93180656 GGCAAGCCCCGCGCCTTCGGCGG + Exonic
1062952522 10:1515553-1515575 GAAAACCCGCCAGCCTTGGGAGG + Intronic
1069770196 10:70893685-70893707 GAGAACCCCCCTACCCTTGGGGG + Intergenic
1079128243 11:17733709-17733731 GAGAAGCTCCCAGCCTTCTGGGG - Intergenic
1081650875 11:44823393-44823415 GAGAAACCACCCGACTTCGGGGG - Intronic
1083553145 11:63606130-63606152 GAGAACCCCTTCACCTTGGGAGG + Intronic
1084682159 11:70672766-70672788 CAGAACCGTCCTGCCTTCGGGGG - Intronic
1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG + Intronic
1104342918 12:127967809-127967831 GAAAACCCCCCCATTTTCGGAGG - Intergenic
1107629175 13:42325969-42325991 CAGAACCTCCCCACCTTTGGAGG - Intergenic
1113820635 13:113209827-113209849 GAGACCCCGCCCGACTTGGGGGG + Intronic
1118593607 14:67419537-67419559 GAGAACCCCCCTGCTTTCTTTGG - Intergenic
1121265402 14:92599227-92599249 CAGAAGCCCCCCGCCCTTGGGGG + Intronic
1123123513 14:105928966-105928988 GGGACCTCCCCGGCCTTCGGCGG + Intronic
1125606350 15:40941883-40941905 GAGAAGCTCGCGGCCTTCGGCGG - Intergenic
1128184198 15:65630479-65630501 GAGAACCCCCCCTGCCTCTGTGG + Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1139446483 16:67001378-67001400 GAGAACATCGCAGCCTTCGGGGG + Exonic
1149075599 17:52594121-52594143 GAGATCCCCCCAGCCTTGAGTGG + Intergenic
1161062741 19:2223201-2223223 GAGAGCCCCCCCGCCCCAGGAGG - Intronic
1163393680 19:17046163-17046185 GAGAAGCCCCCCACCTGCTGGGG + Intergenic
1165340497 19:35208411-35208433 GAGAACCTCCCCGCCTTTGGGGG + Intergenic
934883945 2:98008071-98008093 GAGACCCCCCCCTCCCTCGCCGG - Intergenic
937093606 2:119222623-119222645 GAGAACCCCCCCACCCCCGCAGG - Intergenic
941123410 2:161558239-161558261 GAGAACCCCCCCTGCTTGTGGGG + Intronic
946166280 2:217866054-217866076 GAGAACCCTCTTGCCTTTGGGGG - Intronic
949044815 2:241867508-241867530 GAGCACCCCCTCTTCTTCGGCGG - Intergenic
1175265369 20:57699885-57699907 GAGAAGCCTCCCGGCCTCGGCGG + Intronic
1179845166 21:44107157-44107179 GAGAAGGCCCCCGCCTTGGGAGG + Intergenic
1181131387 22:20734357-20734379 GAGCACCCCACAGCCTTCGTGGG + Intronic
1181243027 22:21488186-21488208 GAGCACCCCACAGCCTTCGTGGG + Intergenic
1185394230 22:50578535-50578557 CAGAACCCACCCACCTTCCGCGG + Exonic
950667988 3:14508927-14508949 GACAACCCTCCTGCCTTCGCCGG - Intronic
962755881 3:138465176-138465198 GTGAAGCCCCTCCCCTTCGGGGG - Intronic
967904138 3:194486914-194486936 GAGAACCCCCCTCCCCTCCGCGG + Intronic
970159745 4:13176660-13176682 GATAACACCCCCACCTTTGGAGG - Intergenic
980883070 4:138732994-138733016 GGGAACCCCCCCACCTGCAGAGG + Intergenic
983774135 4:171584753-171584775 GAGAAACCACCTGACTTCGGTGG - Intergenic
985784547 5:1886998-1887020 GAGACCCCTCCCCCCTTCCGAGG - Exonic
997473320 5:134128767-134128789 GAGAGCACCCCAGCCTCCGGTGG + Intronic
1001993091 5:176133673-176133695 GAGAACCGCCCCGCCTCCCCAGG + Intergenic
1003617994 6:7672765-7672787 GACAACACCCCCTCCTTGGGTGG - Intergenic
1029494360 7:100889243-100889265 GACAAGCCCCCCGGCTTCCGGGG - Exonic
1045021787 8:98051245-98051267 GAGGACCCTGCCGCCTTCCGCGG + Intergenic
1057997081 9:99828487-99828509 CATAACGCCCCCGCCTGCGGGGG - Exonic
1192368255 X:70492960-70492982 GAGAACCCGCCTGCCTCAGGTGG - Intronic