ID: 1103945399

View in Genome Browser
Species Human (GRCh38)
Location 12:124523352-124523374
Sequence GCTCCTGGGAACCCACACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103945399 Original CRISPR GCTCCTGGGAACCCACACCC CGG Intronic
900106440 1:983265-983287 GCTCCTGGGAAACTCCAGCCTGG - Intergenic
900296806 1:1956012-1956034 GCTGCTGTGATCCCACAACCAGG - Intronic
900731966 1:4268035-4268057 GCTGCCGAGAAGCCACACCCAGG + Intergenic
901665745 1:10825175-10825197 GCTCCTGGGAATTCACACACTGG + Intergenic
902372960 1:16016978-16017000 CATCCTGGGACCCCAGACCCTGG - Intronic
902414815 1:16232366-16232388 CCTCCCTGGAGCCCACACCCAGG + Intronic
902508995 1:16955458-16955480 GCTCCTTGGCACCCTCGCCCAGG - Exonic
902977390 1:20098765-20098787 TCTTCTGGGGAACCACACCCAGG + Intergenic
905302034 1:36992020-36992042 TCTCCTGGGAACCACCCCCCAGG - Intronic
907246619 1:53113236-53113258 GAGCCTGGGAAGCCCCACCCAGG - Intronic
908415051 1:63904958-63904980 CCTCGTGGGATCGCACACCCAGG + Intronic
909946232 1:81666721-81666743 GCTCCTGGAAAGCCTCACCATGG + Intronic
912745347 1:112241246-112241268 GTGCCTGGGAACACACACTCAGG + Intergenic
913111459 1:115660972-115660994 GCACCTCTGAACCCACATCCAGG - Intronic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
915302505 1:154959527-154959549 GGTCCTGGCTACCCACCCCCAGG - Exonic
915348724 1:155211668-155211690 GATCCAGGGAACCCACGCCCAGG - Intronic
915351917 1:155232294-155232316 GATCCAGGGAACCCACGCCCAGG - Intergenic
918575928 1:186060243-186060265 ACCCCTGGGAAACCAGACCCAGG + Intronic
920035209 1:203060919-203060941 GATCCTGGGGACCCACACCCAGG + Intronic
920740534 1:208577519-208577541 GCTCCTGCTAACCCAGACCTGGG - Intergenic
923456450 1:234169438-234169460 GAGCCTGGGAGCCCACAGCCGGG - Intronic
1062931583 10:1356385-1356407 CGTCCTGGGGACCCACCCCCTGG + Intronic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1067757110 10:49013620-49013642 GAACCTGGGAACCCACACATGGG + Intergenic
1069593725 10:69657124-69657146 GCTTCTGGGCCCCCAGACCCAGG + Intergenic
1069837774 10:71319816-71319838 CCTCCTTGGAACCAGCACCCAGG + Intronic
1071178554 10:82956103-82956125 GCTCCTGGGAAGGCAGACCCTGG - Intronic
1071280274 10:84095176-84095198 GCTCATGGGCACTCACAACCTGG + Intergenic
1072716133 10:97753760-97753782 GATCCTAGGAACCCACAGCGTGG - Intronic
1072719635 10:97772414-97772436 GCTCGTGCCACCCCACACCCTGG + Intergenic
1073125500 10:101146524-101146546 CTTCCTGGGACCCCAGACCCGGG + Intergenic
1073136185 10:101221911-101221933 GTTCCTGGGGACCAGCACCCTGG - Intergenic
1075614985 10:123884327-123884349 TCTGCTGGGAACCCTCACACAGG + Intronic
1076343887 10:129767448-129767470 GTTCCTAGCATCCCACACCCAGG + Exonic
1076817758 10:132923123-132923145 GGTCCAGGGAACCCCCACACGGG - Intronic
1077225238 11:1436659-1436681 GCTGCTGGGAAGCCTGACCCTGG + Intronic
1077373355 11:2193882-2193904 GCCCCTGGGAATCCACCCACAGG + Intergenic
1077466196 11:2734857-2734879 GGGCCTGGGAAGCCACAGCCAGG - Intronic
1077507867 11:2940464-2940486 CCTCCTCAGAACCCAGACCCTGG - Intergenic
1078312491 11:10259018-10259040 GCTCCTGGGAACCTAGTCCTTGG + Intronic
1080383812 11:31798921-31798943 GCTCATGGGAGCCCACGCACCGG + Intronic
1082966614 11:58972621-58972643 GCTCAGAGGGACCCACACCCAGG + Intronic
1083293574 11:61703234-61703256 TCCCCTGAGAAGCCACACCCTGG + Intronic
1084091695 11:66883043-66883065 GCTCCTGGGGGCCCAGAGCCCGG - Intronic
1084155053 11:67308602-67308624 CCACCTGGGAGCCCACACCAGGG - Intronic
1084223076 11:67696816-67696838 GCACCTGGGCACCTCCACCCGGG + Intergenic
1084527385 11:69705327-69705349 CCTCCTGGGGCCCCACATCCAGG - Intergenic
1085297555 11:75439572-75439594 GCTGGTGGGAACCCATGCCCTGG + Intronic
1089065931 11:115662081-115662103 GCCCCTGGGTCCCCACACCTGGG + Intergenic
1089279009 11:117359513-117359535 CCTGCTGGGAACCCACCCACCGG + Intronic
1089467135 11:118692604-118692626 GCTCCTGAGCACCCACTCTCAGG + Intergenic
1089792552 11:120955267-120955289 GCTCCTCGGGACCCACACAGAGG + Intronic
1089818533 11:121199682-121199704 GCCCCTAGGAATCCACACACAGG - Intergenic
1090189539 11:124759316-124759338 CCTCCTTGAAACCAACACCCCGG - Intronic
1090801317 11:130174218-130174240 CCTCCTGGGGGCCCACAGCCAGG + Intronic
1090830397 11:130416952-130416974 GCTCCAGGCGGCCCACACCCTGG - Exonic
1091973117 12:4804731-4804753 GCTCCTGGAAACCAACAACCAGG - Intronic
1092026468 12:5244991-5245013 GCTCCTGGCAGCCCACAGCTTGG + Intergenic
1092045837 12:5431475-5431497 GCTCCCGGGGACCCGCACCCAGG - Intergenic
1099228888 12:80000475-80000497 GCTCTTGGGAAGACAGACCCAGG + Intergenic
1100819182 12:98415191-98415213 GCTTGTGGGAACCCTCACCCTGG - Intergenic
1101574400 12:105984061-105984083 GCTCCTAGGAACCCCCACTGAGG + Intergenic
1101891911 12:108724524-108724546 TCACCAGGGAACTCACACCCAGG + Intronic
1102539605 12:113609277-113609299 GGTGCTGGGATCCCAGACCCTGG + Intergenic
1102648629 12:114420340-114420362 GCTCCTGGGAGCCTCCACCCAGG - Intergenic
1103362740 12:120363313-120363335 GCAGCTGTGCACCCACACCCTGG + Intronic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1104913502 12:132251830-132251852 GCCTCTGGGCACCCACAGCCTGG + Intronic
1105890533 13:24679878-24679900 GCTCCTGCGCACCCGCAGCCTGG + Intergenic
1105927681 13:25021926-25021948 GCTCCTGTGACCCCTCACCGTGG + Intergenic
1112399488 13:99063404-99063426 ACACCTGGGTACCCACACCCAGG - Intronic
1113076452 13:106472271-106472293 GCGCCTGGGAACCCACAGGGCGG - Intergenic
1113670144 13:112170726-112170748 GCTGCTGGGACCCCAAGCCCAGG - Intergenic
1114459371 14:22877080-22877102 GCTCCCTCGAACCAACACCCCGG + Exonic
1115850073 14:37584013-37584035 GCTCCTGGGGACCCGCACACAGG - Intergenic
1117992868 14:61452011-61452033 CCCACTGGGAACCCATACCCAGG - Intronic
1118514433 14:66509362-66509384 CTTTCTGGGAACCCCCACCCCGG + Intronic
1118717418 14:68570155-68570177 GCTCCTGGGTCCCCATACCCAGG + Intronic
1119525702 14:75320740-75320762 GTTGCTGGGTACCCACACCTGGG + Intergenic
1121671790 14:95715597-95715619 GCTCCTGGGTACCCCTTCCCTGG - Intergenic
1122172805 14:99890569-99890591 GCACTTGGGAAACCAAACCCAGG - Intronic
1122775621 14:104115864-104115886 GCCCCTCGGACTCCACACCCAGG + Intergenic
1122786919 14:104168144-104168166 CCTCCTGGGCAGCCACACCTTGG + Intronic
1202903782 14_GL000194v1_random:57252-57274 GCTCCTGAGGACCCAAACTCTGG + Intergenic
1124011383 15:25842091-25842113 GCTCCAGGAGACCCAGACCCAGG - Intronic
1124169737 15:27361618-27361640 GGTCCTGGGAAACCTCTCCCTGG - Intronic
1124631747 15:31341809-31341831 GCTCCTGGCATCCCAGCCCCAGG + Intronic
1125259634 15:37808493-37808515 GTTTCTGGGGACCCACAGCCTGG + Intergenic
1125512887 15:40302378-40302400 GCTCCTGAGCACCCCCGCCCAGG + Intronic
1125970022 15:43904010-43904032 GCACCTGGGAAGGCACACCGAGG + Intronic
1127259300 15:57316732-57316754 GCTCCAGGGAACCCTCTCCTAGG + Intergenic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1131473876 15:92719467-92719489 GCTTCTCGAAACCCACTCCCTGG - Intronic
1131506561 15:93025056-93025078 GGTCCTGGGAACACTGACCCTGG - Exonic
1136142271 16:28295056-28295078 GCTTCTGGGAACCCCCACTGGGG - Intronic
1136518478 16:30781951-30781973 GCACCAAGAAACCCACACCCAGG - Exonic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1139373337 16:66481533-66481555 GCGCCTGAGACCCCAGACCCAGG - Exonic
1141828344 16:86496183-86496205 GGTCCAATGAACCCACACCCAGG + Intergenic
1141865716 16:86748598-86748620 GCTCCTGGCAACTCAAACCAAGG - Intergenic
1141908895 16:87045144-87045166 GCTCCTGGAGACCCACAGCCAGG + Intergenic
1142606914 17:1087231-1087253 GCTGCTGTGGACCCCCACCCCGG + Intronic
1143175671 17:4953555-4953577 AGCCCTGGGAACCCCCACCCCGG - Intronic
1143401274 17:6645431-6645453 GCTCCTTGGAAACCACAGTCTGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145903960 17:28506392-28506414 GCTCCTGGCCCCCCAGACCCGGG + Intronic
1147740639 17:42669474-42669496 GCTAATGGGCCCCCACACCCTGG - Exonic
1147754932 17:42761640-42761662 GCTCCTTGTCACTCACACCCAGG - Intronic
1149773901 17:59342421-59342443 GCACCAGGGAACCCTCCCCCTGG - Intronic
1150640733 17:66947904-66947926 GCTCCTGGGCAAGGACACCCAGG - Intergenic
1151545704 17:74791630-74791652 GCCACTGGGAAGCCACGCCCAGG - Intronic
1151718921 17:75844818-75844840 CCTCTTGGGAGCCCCCACCCTGG - Intergenic
1152088282 17:78233236-78233258 GCTCCTGGGAAGCCTCGCTCTGG - Intronic
1152471453 17:80492148-80492170 GCTCCTGGGAACCCAGACACAGG + Intergenic
1152600452 17:81259606-81259628 GCACCTGGAAAGCCACACTCAGG + Intronic
1152791283 17:82281405-82281427 GCTCCTGGAATACCACCCCCAGG - Intergenic
1152812087 17:82386891-82386913 GGCCCTGGGACCCCGCACCCAGG - Intergenic
1152931323 17:83111643-83111665 GCTCCAGGGAAACCACCGCCTGG - Intergenic
1156364105 18:36409487-36409509 GTTCCTGGGAACACAAACCCTGG - Intronic
1161610162 19:5237954-5237976 GCCCCTGTGTACACACACCCAGG + Intronic
1161663543 19:5561381-5561403 CCACCTGGGAGCCCAGACCCTGG + Intergenic
1163455836 19:17405149-17405171 GCTCCTGGGCCCCCACATCAAGG - Intronic
1164624159 19:29715372-29715394 GCTGCTGGGCACCCCCTCCCCGG + Intronic
1164927473 19:32141275-32141297 GCTCCTGGGAACCCCAAATCTGG - Intergenic
1166547288 19:43640789-43640811 GCTCAGGGAAACCCACTCCCAGG - Intergenic
1167087975 19:47323729-47323751 GCTGCCGGGAGCCCACCCCCAGG - Intergenic
1167201257 19:48067083-48067105 ACTCCTGGGAACTCACACTGAGG - Intronic
1167526038 19:49984401-49984423 GCTCCTGGAAACCCTCACCTGGG - Intronic
1167614788 19:50526434-50526456 GCTCCAGGGAACCCAGCCCCGGG - Intronic
1168678290 19:58294966-58294988 GCACCTGAGAACTCACACCGAGG + Exonic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
925286827 2:2721510-2721532 GCACCTGGGTCTCCACACCCTGG + Intergenic
926546290 2:14244850-14244872 CCTCCTGGGAGCCCAAACCTAGG + Intergenic
926781817 2:16479972-16479994 GATGGTGGGACCCCACACCCAGG + Intergenic
927285881 2:21356279-21356301 CCTCCTGAGGACCCCCACCCCGG - Intergenic
927480375 2:23449075-23449097 GATGCTGGGAACACACAGCCTGG - Intronic
929901610 2:46008541-46008563 GCTCCTGGGATCACATGCCCTGG + Intronic
930170475 2:48246677-48246699 GGTCCAGGGAGCCCTCACCCTGG + Intergenic
931286472 2:60835964-60835986 GCTGCTGAGATCCCACTCCCAGG - Intergenic
932578128 2:72973836-72973858 TCTCCTGGGAACCGAAAGCCTGG - Intronic
932658100 2:73627561-73627583 GCTCCTGGAAATTCAGACCCAGG - Intergenic
932664727 2:73687598-73687620 GCTCCTGGAAATTCAGACCCAGG - Intergenic
933567049 2:83962859-83962881 CCTCCTTGGACCTCACACCCTGG + Intergenic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
936030090 2:109063625-109063647 GCACCTGGGTACACACACACAGG + Intergenic
936155078 2:110042015-110042037 GCCCCAGGAAAGCCACACCCGGG - Intergenic
936189604 2:110329399-110329421 GCCCCAGGAAAGCCACACCCGGG + Intergenic
936483421 2:112906531-112906553 ACTCCTAGGAGCCCACGCCCTGG - Intergenic
937267519 2:120625877-120625899 GCACCTGGTGACCCACACCCTGG - Intergenic
937428756 2:121820868-121820890 TCTCCTGGGATCCCACTGCCCGG - Intergenic
937895475 2:126974140-126974162 CCGCCTGGGAACCCCCACCAGGG + Intergenic
938064367 2:128273085-128273107 GCTGCTGGGGAACCACACCAGGG + Intronic
938087034 2:128408519-128408541 GGTCTTGGGAACACACACCTTGG + Intergenic
938717271 2:134032092-134032114 TCTCCTGGGAAGCCACACACTGG + Intergenic
942176186 2:173336541-173336563 GAACCTGAGAACCCACACACGGG - Intergenic
942785854 2:179701267-179701289 GCTCCGGGGAATCCTTACCCTGG - Intronic
943541672 2:189222957-189222979 ACTCCTGGGAACACTCACACTGG - Intergenic
944906294 2:204265194-204265216 CCTCCTGGTAACCCACAGCTGGG - Intergenic
946239428 2:218344846-218344868 GTTCCTGAGAACCCACTGCCTGG + Exonic
947566308 2:231196180-231196202 GCTCCAGGGAACTCAGATCCTGG + Intergenic
948466683 2:238155576-238155598 GCTGCTGGGAAGCCAGGCCCGGG + Intergenic
948582188 2:238996163-238996185 GTTCCAGGCAACCCAGACCCTGG + Intergenic
948961703 2:241344058-241344080 GGTGCTGAGAACCCTCACCCAGG + Intronic
949037622 2:241824456-241824478 CCTCCTGCAAACCCCCACCCTGG + Intergenic
1168890654 20:1293715-1293737 TCTCCTGGGCACCCAGAGCCAGG - Intronic
1170829675 20:19829416-19829438 GCTCCTGTGAACTCACCCCTGGG - Intergenic
1171196641 20:23205082-23205104 CCTCCTAGGAATCCAGACCCGGG + Intergenic
1171198969 20:23225854-23225876 GCTCCTGGGAACCTCCGGCCTGG - Intergenic
1172668038 20:36614227-36614249 ACCCCTGGGAAGCCACAACCCGG - Intronic
1173088933 20:39951886-39951908 CCGCCTGGGAACCCACCTCCTGG - Intergenic
1173340201 20:42146424-42146446 GCTAATGGTAACCCAAACCCTGG - Intronic
1174140951 20:48413264-48413286 GCTTCTGGGAAACCAAAGCCAGG + Intergenic
1175252265 20:57616732-57616754 GCCCTCTGGAACCCACACCCGGG - Intronic
1176019682 20:62956317-62956339 GTTCTTGGGAGCACACACCCGGG + Intronic
1176386403 21:6140373-6140395 GCTCCTTAGAACAGACACCCTGG + Intergenic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1178431137 21:32519875-32519897 GCTCCTGAGACCCCACAGCTTGG - Intergenic
1179737070 21:43397879-43397901 GCTCCTTAGAACAGACACCCTGG - Intergenic
1180093725 21:45544810-45544832 GCTCCTGGGCCCCCACTCCCCGG + Intergenic
1180965846 22:19787596-19787618 GCTCCTTGGGACCCCCACCTGGG - Exonic
1180980769 22:19877039-19877061 GCTCCTCGGAGGCCAGACCCAGG - Exonic
1181427961 22:22856258-22856280 AATCCTGGGACCCCACAGCCAGG + Intronic
1183301049 22:37059366-37059388 GCTCCTTGGACACCACACACAGG - Exonic
1183952041 22:41357588-41357610 GCGCCTGGGTACGCACACCGGGG - Exonic
1184031634 22:41898501-41898523 GCCTCTGGGCTCCCACACCCAGG - Intronic
1184075016 22:42171195-42171217 GCTCCTGGAGACCGACAGCCAGG + Intronic
1184869468 22:47226081-47226103 GCCCCTTGGCACCCACAGCCTGG - Intergenic
1184976480 22:48065990-48066012 GCACCTGAGAGCCCACAGCCAGG - Intergenic
1185041653 22:48507399-48507421 GCTCCTGTGAACCCCCAACCCGG + Intronic
1185049007 22:48543988-48544010 GCTCCAGGCAGCCCACACCATGG + Intronic
1185204497 22:49529667-49529689 GCTCCTTAGAACCCACATGCGGG + Intronic
1185419752 22:50728796-50728818 CCACCTGGGCACCCACCCCCAGG + Intergenic
950565820 3:13768956-13768978 GCTGCTGGGAACCAATACCTGGG - Intergenic
950688526 3:14636755-14636777 GCTCCTGGGCATTCACTCCCAGG + Intergenic
950777312 3:15361932-15361954 GCTCCTCTGAGCCCACACACAGG + Intergenic
955065650 3:55531686-55531708 GCTGATGGGAACCCTCAGCCAGG + Intronic
958977221 3:100682168-100682190 CGCCCTGGGAACCCACCCCCGGG + Intronic
961039462 3:123667036-123667058 TCTCCTGGGATCACATACCCAGG + Intronic
961213019 3:125140403-125140425 GGGCCTGGGAACCCACCTCCTGG - Intronic
961260128 3:125595435-125595457 GCTCCTGGGAACCCAGTCGAGGG - Intergenic
964431069 3:156606269-156606291 GCTTCTGGGCACACGCACCCCGG - Intergenic
965261323 3:166489564-166489586 GCTCCTTGGCACCTACAGCCAGG + Intergenic
966474341 3:180326143-180326165 GCTTCTGAGAAGCCAGACCCTGG + Intergenic
967197351 3:187039976-187039998 TTTCCTGGGAAACCACACCTTGG + Intronic
967259039 3:187623782-187623804 GTGCCTGGGAACGCACTCCCTGG - Intergenic
968386336 4:142482-142504 ACTCCTGTTAACCCACACCGTGG + Intronic
968441160 4:625206-625228 CCTCCTGGGAGCCCAGACCTGGG - Intergenic
968501298 4:951457-951479 GCCCCTGGTCCCCCACACCCTGG - Intronic
969594293 4:8140160-8140182 GCACCTGTTAACCCACACCAAGG - Intronic
969631914 4:8343862-8343884 GCTGCTGGGAGCCCAGCCCCTGG + Intergenic
970050229 4:11905932-11905954 GCTGCTAGGAACCCACAGCATGG + Intergenic
979787993 4:124740711-124740733 GCCCCTGGCATGCCACACCCTGG - Intergenic
980180193 4:129392642-129392664 GCCCCTGGGCACCTACAGCCTGG + Intergenic
980835065 4:138181232-138181254 GCTCTTGGCTATCCACACCCAGG + Intronic
983422370 4:167535602-167535624 GCTACTGGGAACGCACAGCAGGG - Intergenic
984020017 4:174474523-174474545 GCTCCTGGGAAACCAGAGCATGG + Intergenic
985664364 5:1174291-1174313 GCTCCAGGGCACCCCCTCCCCGG + Intergenic
988051326 5:26035245-26035267 GCTGCTGGGAAGTTACACCCTGG + Intergenic
992364965 5:76082313-76082335 GCTCCCGTGAGGCCACACCCAGG - Intergenic
992561612 5:77958084-77958106 GCTCGCGGGAACCCCCACCTCGG + Intergenic
992611209 5:78510048-78510070 GCTCCGGGGAGCCCCCGCCCGGG + Exonic
993095178 5:83472531-83472553 GTTCCTGGAAAGCCACTCCCGGG + Intronic
993899911 5:93578476-93578498 GCTCCCGGGAGCCCAGGCCCCGG + Intergenic
994118801 5:96090982-96091004 GCACCTGGGAACCTGCACACAGG - Intergenic
998806062 5:145918860-145918882 GTGCCTGGGACCTCACACCCTGG + Intergenic
1002304131 5:178273549-178273571 GCTCCCGGGAGCCCCCACCAAGG + Intronic
1004127726 6:12889882-12889904 CCACCTGGGAAACCACATCCTGG + Intronic
1005386704 6:25292530-25292552 CCTCCTGAAAACGCACACCCAGG - Intronic
1007787727 6:44290843-44290865 TCTCCTGGGGAGCCACACCTGGG + Intronic
1008753370 6:54763888-54763910 GATCCTGGGCAACCACACACTGG - Intergenic
1010577029 6:77544411-77544433 GCTCCTGACAATCCACATCCAGG + Intergenic
1010983966 6:82401205-82401227 GAACCTGGGAACCCGAACCCAGG - Intergenic
1012100948 6:95084769-95084791 CCTCCTGGGAGCCCAGACCTTGG + Intergenic
1013465073 6:110410853-110410875 GCTCCTGGGAACTGCCTCCCAGG - Intronic
1019156871 6:170045093-170045115 GCTCCAGGGAACCTACACATGGG + Intergenic
1019422969 7:959553-959575 GACCCTGGAAACCCACTCCCCGG + Intronic
1019503943 7:1381204-1381226 GAGCCTGGGACCCCACACTCAGG - Intergenic
1020105442 7:5420442-5420464 GGCCCTGGGAACCTGCACCCCGG - Intronic
1022120411 7:27302899-27302921 GCTCCTGGAAGCCCTAACCCAGG + Intergenic
1022477334 7:30720131-30720153 TCTCCTGAGACCCCACATCCAGG - Intronic
1022941933 7:35249733-35249755 GGTCATGGGAAGCCCCACCCTGG - Intronic
1022975302 7:35550667-35550689 GCGCCTGGGTAACCTCACCCAGG - Intergenic
1023496310 7:40800983-40801005 GTGCCTGGGAACACAAACCCTGG - Intronic
1024951660 7:54867219-54867241 GTTCCTGGGTACCCAGGCCCTGG + Intergenic
1024988102 7:55213343-55213365 GCTCCTGAGCCTCCACACCCTGG + Intronic
1026873867 7:73869020-73869042 GCTCTTGGGACCCCACTCCCTGG + Intergenic
1028031518 7:85920273-85920295 TCTCCTGTGAGCCAACACCCAGG - Intergenic
1032095908 7:128938417-128938439 GCTCCCGGGAACCCCCATTCTGG - Intronic
1032188943 7:129751771-129751793 CCTCCAGGGAACCCACATACTGG - Intronic
1032683371 7:134208091-134208113 GCTCCTGAGGACCCCCATCCAGG - Intronic
1034349483 7:150406827-150406849 CCCCCTGGGAGCCCACACCCTGG + Intronic
1034964848 7:155384586-155384608 CCTCCTGGGCCCTCACACCCTGG + Intronic
1035908347 8:3538364-3538386 GCACCTGGGATTCCACACCTGGG + Intronic
1035931557 8:3785725-3785747 GCTCCTGGCTCCCCGCACCCTGG - Intronic
1037608800 8:20459225-20459247 GCTGTTGGGATTCCACACCCTGG + Intergenic
1038004225 8:23416447-23416469 CCTCCTGTGAGCCCAGACCCAGG + Intronic
1038671600 8:29587699-29587721 GCTCCAGGGAACCCTCTCTCGGG - Intergenic
1040776143 8:51045161-51045183 GCTCCTGGAAACTCACACAGTGG + Intergenic
1040984649 8:53280357-53280379 GCTCCTGGGAAACCACAAAGAGG + Intergenic
1043414429 8:80033240-80033262 CCTTCTGGGAGCCCACACCTTGG - Intronic
1045794180 8:106023669-106023691 GCTCGGAGGGACCCACACCCAGG + Intergenic
1046424329 8:114026720-114026742 GATTGTGGGAACCCACACCAAGG + Intergenic
1048307065 8:133291848-133291870 GCCCCTCTGGACCCACACCCAGG - Intronic
1049423522 8:142527102-142527124 CCTCCGGGGAACCCAAGCCCAGG + Intronic
1049478390 8:142807412-142807434 GCTGCTGGGCACCCACCCCAAGG + Intergenic
1049812408 8:144581432-144581454 GCTCCTGAGCACCCGCAACCGGG + Intronic
1050973963 9:11912581-11912603 GGTCTTTGGAACCCACAACCAGG - Intergenic
1051036641 9:12754671-12754693 GCTTCTGAGAACTCAGACCCAGG - Intergenic
1053294412 9:36902636-36902658 GGGCATGGGAAGCCACACCCTGG + Intronic
1058974669 9:110114861-110114883 GCTCCTGGGATTCCACAGTCGGG + Intronic
1059426180 9:114222324-114222346 GCTCCTGGCTCCCCACACGCTGG - Intronic
1060202098 9:121657238-121657260 GCTCCAGGGACCTCACACCAGGG - Intronic
1060549313 9:124477654-124477676 GGGCCTGGGATCCCACAACCCGG - Intronic
1061395132 9:130339750-130339772 GCTCCTGGGCACCCAGGCCCTGG + Intronic
1061619083 9:131799290-131799312 GCACCTGCTAACCCACCCCCAGG - Intergenic
1061671006 9:132188181-132188203 CTACCTGGGCACCCACACCCAGG + Intronic
1061947966 9:133919440-133919462 GCTCCTGGAACCCCTCACCCAGG - Intronic
1062019311 9:134308930-134308952 CATCGTGGGAACCCACACCATGG + Intergenic
1186067281 X:5779357-5779379 GTTTCTTGGAACCAACACCCAGG - Intergenic
1188132167 X:26449541-26449563 TCCCCTGGGAACCCACATACAGG - Intergenic
1190337360 X:49270324-49270346 GCCCCCAGGCACCCACACCCCGG - Exonic
1196844369 X:119886938-119886960 TCTCTTGGGACTCCACACCCTGG - Intergenic
1198312563 X:135436289-135436311 GCTCCTTGGCACCCTCGCCCAGG - Intergenic
1198619304 X:138488841-138488863 TCTCCTGGGCGCCCACAGCCTGG + Intergenic
1199785233 X:151099337-151099359 GATCCTGGGAACCAGTACCCAGG + Intergenic