ID: 1103945995

View in Genome Browser
Species Human (GRCh38)
Location 12:124526730-124526752
Sequence CTGCGCTTCTCGGAGAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103945989_1103945995 1 Left 1103945989 12:124526706-124526728 CCAGCCTGGGGTGCACACAGCTC 0: 1
1: 0
2: 2
3: 34
4: 317
Right 1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1103945990_1103945995 -3 Left 1103945990 12:124526710-124526732 CCTGGGGTGCACACAGCTCCCTG 0: 1
1: 1
2: 2
3: 43
4: 297
Right 1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1103945987_1103945995 11 Left 1103945987 12:124526696-124526718 CCCAGCAAAGCCAGCCTGGGGTG 0: 1
1: 0
2: 3
3: 18
4: 219
Right 1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1103945982_1103945995 24 Left 1103945982 12:124526683-124526705 CCACAGCAAGAACCCCAGCAAAG 0: 1
1: 0
2: 2
3: 18
4: 236
Right 1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1103945988_1103945995 10 Left 1103945988 12:124526697-124526719 CCAGCAAAGCCAGCCTGGGGTGC 0: 1
1: 0
2: 4
3: 28
4: 295
Right 1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1103945986_1103945995 12 Left 1103945986 12:124526695-124526717 CCCCAGCAAAGCCAGCCTGGGGT 0: 1
1: 1
2: 0
3: 51
4: 326
Right 1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103945995 Original CRISPR CTGCGCTTCTCGGAGAGGAC AGG Intronic
900601540 1:3504861-3504883 CTGGGCTTCTCTCAGAGGCCGGG - Intronic
900854548 1:5170533-5170555 CAGCCTTTCTCTGAGAGGACGGG - Intergenic
905173882 1:36124806-36124828 CCTCGCTTCTGGGAGAGGAAGGG + Intronic
908380698 1:63594196-63594218 CTGCTATTCTCGGCTAGGACTGG + Intronic
910693102 1:89984715-89984737 CTGCGCTCCTCGGGGAGGCTCGG + Intergenic
917488989 1:175481495-175481517 CTCTGCTGCTTGGAGAGGACAGG + Intronic
918519857 1:185403861-185403883 CTGCGGACCTCGGCGAGGACAGG + Intergenic
923161410 1:231317671-231317693 CTGGGCTTCTAGGAGAGGTGGGG + Intergenic
924129360 1:240889569-240889591 CTCCGCTTCTAGGAGGCGACTGG + Intronic
924573175 1:245256612-245256634 ATGCCCTTCGCGGAGAGGAGAGG - Intronic
1069731469 10:70617984-70618006 CTGCGCTCCTGCGAGAGCACTGG - Intergenic
1070172184 10:73941117-73941139 CTGCCCTGCTCAGAGAGGCCAGG - Intergenic
1072446339 10:95501888-95501910 CTGCCCTTCTAGGAGCCGACAGG + Intronic
1075754022 10:124796537-124796559 CTGCTCTTCTTGGTCAGGACTGG + Intergenic
1077584374 11:3439519-3439541 CTGGGCTGTTCGGAGGGGACAGG + Intergenic
1078595997 11:12687351-12687373 CTGGGCTTCTTGGATAGGAAGGG + Intronic
1083473082 11:62897455-62897477 CTGCTATTCACGGAGAGGCCTGG + Intergenic
1084488670 11:69465824-69465846 CTGCGCTTTGCCGGGAGGACAGG - Intergenic
1085274845 11:75291851-75291873 CTGTGCTCCTGGGGGAGGACTGG - Intronic
1089359498 11:117876600-117876622 CTGGGAGTCTCGGAGGGGACCGG - Exonic
1090629495 11:128633708-128633730 CTGAGCTTGTGGGAGAAGACAGG - Intergenic
1096124435 12:49109420-49109442 CTGCTCTTATCTGTGAGGACAGG - Intronic
1097938630 12:65279339-65279361 CCGCGCGCCTCGGAGAGGACGGG + Intronic
1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG + Intronic
1110141302 13:72132612-72132634 CTGGCCTTCTCTCAGAGGACTGG - Intergenic
1113462935 13:110494294-110494316 CTCAGCTTCTTGGGGAGGACAGG - Intronic
1119328694 14:73777815-73777837 CTGCGCTCAGAGGAGAGGACTGG - Intronic
1119726568 14:76925047-76925069 GGGCTCTTCTCGGAGAGGCCAGG + Intergenic
1123040345 14:105487757-105487779 CAGCCCTTCTCGGCGGGGACAGG - Intronic
1124023319 15:25943251-25943273 ATGGGCTTCTGGGAGAGGAACGG + Intergenic
1132598116 16:762392-762414 CTGCCCTTCTGGGAGAGGGGTGG + Intronic
1133738360 16:8632652-8632674 CAGCGCTTCTGAGAGAGCACAGG - Intronic
1136552584 16:30989499-30989521 CTCCCCTTCTCAGAGGGGACAGG - Exonic
1139750841 16:69107860-69107882 CCGCGCTTCCCGGAGAGGCTAGG + Intronic
1140901173 16:79369453-79369475 CTGCTCTTCTCTTTGAGGACAGG + Intergenic
1144142324 17:12361715-12361737 CTGGGCTTCAGAGAGAGGACTGG + Intergenic
1147971025 17:44219208-44219230 CCGCGCTTCTCGGAGCCGGCAGG - Intronic
1151884125 17:76913435-76913457 CTGCTCTTCTCTGAGGGGAGAGG + Intronic
1152490749 17:80631510-80631532 CGGGCTTTCTCGGAGAGGACGGG + Intronic
1154356308 18:13625087-13625109 CTGCGCTCCACAGAGGGGACAGG - Intronic
1155342542 18:24827315-24827337 CTGTGCTTCCCGGAGGGGAGGGG + Intergenic
1159296725 18:66500119-66500141 CTGCTCCTCTGGGAGAGGATAGG - Intergenic
1160682416 19:417914-417936 CTGCGCTTCTGGGCCAGGTCAGG - Intronic
1161601028 19:5182864-5182886 CTGGGTTTCACGGAGAGGTCTGG + Intronic
1164469517 19:28518370-28518392 GTGTGCCTCTCTGAGAGGACAGG + Intergenic
1165916247 19:39262652-39262674 ATGCCCTTGGCGGAGAGGACAGG - Intergenic
1166884936 19:45954479-45954501 CTGGGCTTTTTGGAGAGGATGGG + Intronic
925161653 2:1688408-1688430 CTGCGCAGCTCACAGAGGACTGG + Intronic
925276579 2:2653356-2653378 CTGAGCTTCTCGCAGAGGGGAGG - Intergenic
927667565 2:25042734-25042756 CTGCGCGGCTCGGAGAAGGCGGG + Intronic
928387839 2:30884856-30884878 CTGGGCTGGTGGGAGAGGACCGG - Intergenic
938827785 2:135023464-135023486 CTGGGCTTGTGGGAAAGGACCGG - Intronic
941099605 2:161281774-161281796 TTGCCCATCACGGAGAGGACAGG - Intergenic
945178160 2:207064519-207064541 CTGCAATTCTTGGAGAGCACTGG - Intergenic
946338497 2:219054339-219054361 CTCCCCTCCTCGGAGAGGCCTGG - Intergenic
949000617 2:241610733-241610755 CAGCGCTCCTCAGAGGGGACCGG + Intronic
1170736475 20:19017600-19017622 CTGAGCCTCTAGGAGAGGAGGGG - Intergenic
1176015488 20:62929180-62929202 TTCCGGTTCTTGGAGAGGACGGG - Intronic
1178906321 21:36639934-36639956 CTAAGCATCTCAGAGAGGACAGG + Intergenic
1179646193 21:42777773-42777795 CTGTGCTCCTCTGAGAGGACAGG + Intergenic
1183065851 22:35362183-35362205 CTGTGCTCCTCAGAGAGGCCTGG - Intergenic
1185130875 22:49037933-49037955 CTGGGCTTCTCGAAGTGAACCGG + Intergenic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
969526624 4:7707106-7707128 CTGCTCGGCCCGGAGAGGACAGG - Intronic
969754441 4:9139274-9139296 CTGGGCTGTTCGGAGGGGACAGG - Intergenic
982291677 4:153788723-153788745 CTGCGCTTGTAGGAGAAGTCGGG + Exonic
1010491035 6:76476759-76476781 CTGGGCTTTTAGGAGAGTACAGG - Intergenic
1023986673 7:45101121-45101143 CTGGGCTCCTGGGAGAGGCCCGG + Intronic
1024473533 7:49787844-49787866 CTTAGCTTCCTGGAGAGGACTGG - Intronic
1024588070 7:50858093-50858115 CTCAGCTTCTGGGAGGGGACAGG + Intergenic
1026805109 7:73424400-73424422 CTGCGCTGCTCGGGGAGCCCCGG - Intergenic
1031519305 7:122743972-122743994 CTGTGCTTATGGAAGAGGACAGG - Intronic
1034200521 7:149280718-149280740 CTGTGCTTCCCTGAGAGGGCAGG + Intronic
1035127177 7:156616866-156616888 CTGCGCTGCAGGGAGGGGACGGG - Intergenic
1036684346 8:10899306-10899328 GTGGGCTTCTCTGAGAGCACAGG - Intronic
1048984882 8:139730053-139730075 CTGCGTTCCTCAGGGAGGACCGG - Intergenic
1049625156 8:143616599-143616621 CTGGACTTCCTGGAGAGGACTGG - Exonic
1052313461 9:27092919-27092941 CTGCGCTCCTCGGGGAGGCTGGG - Intergenic
1061385476 9:130286961-130286983 CTGTGCTCCTGGGAGCGGACGGG - Intronic
1203568631 Un_KI270744v1:111674-111696 TTGCCCATCACGGAGAGGACAGG + Intergenic
1185750829 X:2608927-2608949 CTGCCCTTCTTGGAGAGGTGTGG - Intergenic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic