ID: 1103950637

View in Genome Browser
Species Human (GRCh38)
Location 12:124549262-124549284
Sequence CTGAGGGGCTGGCGGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 1, 2: 7, 3: 62, 4: 733}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103950628_1103950637 3 Left 1103950628 12:124549236-124549258 CCGCACTGAGACAGGCAGGCACG 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG 0: 1
1: 1
2: 7
3: 62
4: 733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103950637 Original CRISPR CTGAGGGGCTGGCGGTGGGA GGG Intronic
900077127 1:827068-827090 CGTAGGGCCTGGCGGAGGGAAGG + Intergenic
900183751 1:1323879-1323901 CTGAGGGGCTTGCGGGGTTAAGG + Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900357198 1:2270679-2270701 CAGAGGGGCTGGAGGTGGGGCGG + Intronic
900364126 1:2303887-2303909 CTGCTGGGCCGGCGGTGCGAGGG - Exonic
900941180 1:5799572-5799594 CCCAGGAGCTGGGGGTGGGAGGG + Intergenic
901636388 1:10672207-10672229 GGGAGGGGGTGGCGGGGGGAGGG - Intronic
902262538 1:15237524-15237546 CTGAGGGGCTGGGGTTGGAGAGG - Intergenic
902513315 1:16977554-16977576 CTGGTGGGCTGGAGGTGGGGCGG - Intronic
902621956 1:17655958-17655980 CACAGGGGCTGCCAGTGGGAAGG - Exonic
902624881 1:17670831-17670853 GTGAAGGCCTGGTGGTGGGAAGG - Intronic
903661012 1:24978684-24978706 CTGGAGGGCTGGGGCTGGGAGGG - Intergenic
903738181 1:25543581-25543603 CGGCGGAGCTGGCGCTGGGAGGG + Exonic
904311600 1:29632820-29632842 CTGAGGGGCTGGGGGCTGGGAGG - Intergenic
904341354 1:29837000-29837022 CGAAGGGGGTGGAGGTGGGAGGG - Intergenic
904670161 1:32158665-32158687 GTGGGGGACTGGGGGTGGGATGG - Intronic
904698953 1:32346915-32346937 GAGAGGGGCTGGAGGAGGGAGGG + Intergenic
904768580 1:32868986-32869008 CTGAGGGACTGTCTGGGGGACGG + Exonic
905274112 1:36806077-36806099 GCGAGGGGCTGCCTGTGGGAGGG - Intronic
905289770 1:36913250-36913272 CAGAGGGGCTGCTGGTGGCAGGG - Intronic
905655533 1:39684153-39684175 CTGAGGGGGGTGCGGTGGGTTGG + Intronic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906208375 1:43998963-43998985 CAGAGGGCCTGGCGGGGGAAGGG + Intronic
906423066 1:45686948-45686970 CCAAGGGGCGGGCTGTGGGAGGG - Intronic
906531311 1:46525571-46525593 CCAAGGGGCTGGAGGTGAGATGG - Intergenic
907284353 1:53370557-53370579 ACCAGGGGCTGGCAGTGGGAGGG + Intergenic
908381061 1:63597145-63597167 CTGAGGGGCTGTACTTGGGAGGG + Intronic
911115812 1:94246500-94246522 TGGAGGGGTTGGCGGGGGGAAGG - Intronic
911994513 1:104747529-104747551 ATGAGGGGATAGCAGTGGGAGGG + Intergenic
912167252 1:107056454-107056476 CTGAGGAGCTAAGGGTGGGAGGG + Intergenic
912179710 1:107204998-107205020 CTGAGGCTCTGGCAGAGGGAAGG - Intronic
912812758 1:112806315-112806337 CACAGAGGCTGGCAGTGGGAGGG - Intergenic
913075580 1:115338342-115338364 GTGCGGGGCTGGTGGTGGGGAGG - Intergenic
913201457 1:116498052-116498074 CTCAGGGGCTAGAGGAGGGAAGG - Intergenic
913274129 1:117121553-117121575 CAGTGGGGCGGGCGGCGGGAGGG - Exonic
913323374 1:117606027-117606049 CGGAGGGGGCGGCGGCGGGACGG + Exonic
914377482 1:147085033-147085055 CTGAGTGGCGGAGGGTGGGATGG - Intergenic
915322339 1:155062687-155062709 GGGAGGGGCTGGGGGTTGGACGG + Exonic
916962994 1:169907907-169907929 CTGAGGGCATGTAGGTGGGAAGG - Intergenic
917964211 1:180168249-180168271 CTGCCTGGCTGGCTGTGGGAGGG + Intronic
918304211 1:183231118-183231140 CTGTGGGGTTGGGGGTGGTAAGG - Intronic
919767218 1:201135181-201135203 CTGAGGCGCTGGGGCTGGGAGGG + Exonic
919991303 1:202710000-202710022 CTGAGGGACTGGGGCTGGGCTGG - Intronic
920214160 1:204350462-204350484 CGGAGGGGATGGTGGTGGGATGG - Intronic
920412607 1:205774295-205774317 TTGTGGGGCTGTGGGTGGGATGG - Intronic
920764783 1:208821785-208821807 CTGGGGGGTTGGGGGTGGGGGGG - Intergenic
921303472 1:213772579-213772601 GTGGGGGGTGGGCGGTGGGAAGG - Intergenic
922560374 1:226565211-226565233 CTGAGGGGCAGGGAGAGGGAAGG - Intronic
922899322 1:229123888-229123910 CTGAGGGGCTGGAGGCTGGGTGG - Intergenic
923000795 1:230004963-230004985 CTGCGGGGTTGGGGGTGTGAGGG + Intergenic
923672602 1:236053590-236053612 ATCAGGGGCTGGGGGTGTGAGGG - Intronic
923858182 1:237866940-237866962 CTGGGGGGCTGGTAGTGGCAGGG + Intergenic
923860160 1:237885223-237885245 CTGAAGCGCTGGTGGTGAGAGGG + Exonic
924051112 1:240080416-240080438 GTGAGGGGAGGGGGGTGGGAGGG - Intronic
924139756 1:241010038-241010060 GTGTGGGGCTGGGGGAGGGATGG + Intronic
924150756 1:241126671-241126693 ATGGGGGGCTGGAGGTAGGAGGG - Intronic
924184533 1:241474425-241474447 CTGCAGGGTTGGTGGTGGGAAGG - Intergenic
924458075 1:244234106-244234128 CAGAGGGGGTGGCGGCAGGAAGG - Intergenic
924941714 1:248816731-248816753 TTGAGGCAGTGGCGGTGGGAGGG - Intronic
1063171853 10:3516384-3516406 CTGGGGAGCTGGCTGTGGGCTGG - Intergenic
1063570866 10:7213461-7213483 TTGTGGGGGTGGTGGTGGGAGGG + Intronic
1064075350 10:12264393-12264415 CTGAGGGCCTGGGGGAGGGCGGG - Intergenic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065099667 10:22321040-22321062 CTGGGGGGGCGGCGGGGGGAGGG + Intronic
1065873215 10:29974013-29974035 CTGAGGGGCTGGGTGTGGCATGG - Intergenic
1065917354 10:30364922-30364944 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1066264964 10:33767589-33767611 CTAAGGGGCTAGAGGTGAGAAGG + Intergenic
1067018318 10:42773744-42773766 CAGAGGGCCTGTGGGTGGGATGG - Intergenic
1067048179 10:42997565-42997587 ATGAGGAGCTGGCAGTGGGATGG + Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067660569 10:48233865-48233887 CTCAGGGGCTGGTGGAGGAAAGG + Intronic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1069455884 10:68553409-68553431 CAGAGGGGGTGGGGGAGGGAGGG + Intergenic
1069543904 10:69315794-69315816 ATGAGGGGTTGGGGGTGGGATGG + Intronic
1069582945 10:69577649-69577671 CTGAGGGGATGGTGGAGGCAGGG + Intergenic
1069635079 10:69920092-69920114 CAGAGGCCCTGGCAGTGGGAGGG - Intronic
1069708861 10:70476504-70476526 CTGGGGGGCTGGTGGTGGGCTGG + Intergenic
1069851704 10:71409545-71409567 CTGCTGGCCTGGGGGTGGGATGG + Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070387646 10:75940252-75940274 GTAAGCGGCTGGGGGTGGGAAGG + Intronic
1070446487 10:76509695-76509717 CTGAGAGGCTGTCTGTGTGAAGG + Intronic
1070565831 10:77603299-77603321 CTGAGGGGGTGGAGATGGGTGGG - Intronic
1070694595 10:78552475-78552497 CTGCAGGGGTGGGGGTGGGAGGG + Intergenic
1070812538 10:79305617-79305639 GCGAGGGGCAGGGGGTGGGAGGG + Intronic
1070918626 10:80170522-80170544 CTGAGGGGTTAGGGTTGGGAAGG - Intronic
1071492626 10:86146419-86146441 ATTAGGAGCTGGTGGTGGGAGGG - Intronic
1071554441 10:86591613-86591635 GTGAGGGGCTGGGGGCTGGAGGG + Intergenic
1072410055 10:95193674-95193696 CTCAGCGGGGGGCGGTGGGAGGG - Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073403168 10:103275539-103275561 CAGAGGGGCAGGCTGTGGCAGGG + Intergenic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1074300854 10:112232292-112232314 GTGAAGGGCTGGAGGTAGGAAGG + Intergenic
1074483991 10:113855051-113855073 GTGAGGGGCTGGCGTCGGGGTGG + Intronic
1074786390 10:116845621-116845643 CTGGGGAGCTGACGATGGGAGGG - Intergenic
1074875389 10:117609497-117609519 CATAGGGGGTGGTGGTGGGAAGG + Intergenic
1075266373 10:121002472-121002494 GAGAGGTGGTGGCGGTGGGAAGG + Intergenic
1075724767 10:124605639-124605661 CTGAGTGGCTGGCGAGGCGAGGG + Intronic
1076078262 10:127554877-127554899 CTGAAGGGATGGCAGTGGGCTGG - Intergenic
1076178768 10:128389377-128389399 CTGAGGAGGTGGTGGTGGAAGGG + Intergenic
1076253188 10:128999111-128999133 GTGAAGGGCTGGAGGAGGGAAGG + Intergenic
1076547332 10:131254109-131254131 CAGAGGGGCCGGCCGTGTGAAGG + Intronic
1076707765 10:132311006-132311028 CTGAAGGGCTGGGGGTGGTTTGG + Intronic
1076835029 10:133016711-133016733 CTCAGGGGCTGGCAGTGGGGAGG - Intergenic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077288271 11:1777302-1777324 CTGAGGAGCTGGGGCTGGGCTGG + Intergenic
1077319778 11:1935987-1936009 CAGAGGGGCTGGCCCTGAGACGG + Intronic
1077394999 11:2316338-2316360 CTGAGGGGCAGGAGGTGGGAAGG - Intronic
1077472490 11:2770553-2770575 CTGGGGGGATGCAGGTGGGAGGG - Intronic
1077477457 11:2797159-2797181 CTGGGGGGGTGGCGGGGGGGAGG + Intronic
1078240901 11:9530127-9530149 CTGAAGGCCTGGGGGTGGGTAGG - Intergenic
1078317413 11:10304917-10304939 CTTTGGGGCTGGAGTTGGGATGG - Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1079003318 11:16775460-16775482 CTGAAGGGATGGGGGTGGGGTGG - Intergenic
1079083249 11:17428398-17428420 CTGAGGGGCTGGGGGTGGTTTGG + Exonic
1079386426 11:19984178-19984200 CTGATGGGATGGCTGTGGTACGG + Exonic
1081479442 11:43471427-43471449 ATGACGGGCTGGGGGTGGGAAGG - Intronic
1081701875 11:45157572-45157594 CTGGGAGGTTGGCGGTGGAAAGG - Intronic
1081733003 11:45384734-45384756 CTGTGGGGCTGGCGTTGGGGAGG - Intergenic
1081802416 11:45869263-45869285 CAGAGGGCCAGGCAGTGGGAAGG - Intronic
1081853683 11:46290781-46290803 ATGAGGGGTTGGGGGTGGGGAGG + Intronic
1081931340 11:46873512-46873534 CTGACGGGCTGGCAGTGGACTGG - Exonic
1083169152 11:60912306-60912328 CTGAATGGTTGGGGGTGGGAGGG + Intergenic
1083243836 11:61410203-61410225 CTTAGGAGGTGGAGGTGGGAGGG - Intronic
1083265758 11:61546198-61546220 CGGCGGGGCTGGCGGTGGAGCGG - Exonic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083940595 11:65893373-65893395 CTGAGGAGCTGGGGTTGGGCGGG + Intronic
1084196254 11:67524769-67524791 CAGAGGGGCAGGCGGTGAGATGG - Intergenic
1084857356 11:71997679-71997701 CTGAGGGTCTGGGGGTGGTTGGG + Intergenic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085024125 11:73226694-73226716 CTGAGGTGCTGGTGGAGGGTGGG + Intronic
1085036742 11:73305516-73305538 ATAAGGAGCTGGGGGTGGGAGGG + Intergenic
1085327617 11:75618981-75619003 CTGAGGGGGAGTGGGTGGGAGGG + Intronic
1085887373 11:80536328-80536350 CTGAAAGGCTGGCAGTGTGAGGG - Intergenic
1086487862 11:87327751-87327773 CTGAGAACCTGGGGGTGGGATGG + Intergenic
1086584034 11:88431695-88431717 GTGGGGGGCTGGGGGTGGGGTGG + Intergenic
1087137415 11:94734854-94734876 CTTGGGGGCTGGGGATGGGAAGG + Intronic
1087636955 11:100712566-100712588 CTGAGTGGCAGGTGGTGGGAGGG + Intronic
1089078917 11:115760362-115760384 CCGAGGGGGGGGCGGCGGGAGGG - Intergenic
1089317835 11:117604408-117604430 GGGAGGGGCAGGCGCTGGGAGGG - Intronic
1089735525 11:120547972-120547994 CTCAGAGGGTGGCTGTGGGAGGG + Intronic
1089798191 11:121000280-121000302 CCGAGTTGCTTGCGGTGGGATGG - Intergenic
1090262237 11:125330080-125330102 CTGTGGGGCCGATGGTGGGAAGG + Intronic
1090330116 11:125924779-125924801 CTGAGGGTCTCCCGCTGGGACGG - Intergenic
1091047547 11:132337701-132337723 CTGAGGTGCTGGGCATGGGAGGG - Intergenic
1091227505 11:133966335-133966357 CGGAGGGGCTGGCTCTGCGAGGG + Intergenic
1091238567 11:134037392-134037414 CGGAGGGGAGGGCGGTGGGCGGG + Intergenic
1091294079 11:134460270-134460292 GTGATGGGCTGGGGGTGGGGAGG + Intergenic
1091597295 12:1886648-1886670 CTGAGGGGCTGGCAGCAGAAAGG + Intronic
1091714579 12:2767842-2767864 CTGTGGGGCTGACTGTGGAAGGG - Intergenic
1091747836 12:3003907-3003929 CTGAGGTGGTGGCGGTGGGAGGG - Intronic
1091758847 12:3074195-3074217 CTGAGGGGCTGACAGTTGGAAGG - Intergenic
1092049334 12:5456660-5456682 CTGAGGGTCTGGCTCTGGGAGGG + Intronic
1092112129 12:5971298-5971320 CTGAGGGGCTGGTTTTGGGATGG - Intronic
1092173110 12:6385391-6385413 CTGAGGGGCTGGATGTGAAAAGG + Intronic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1093936212 12:25003451-25003473 CTCAGGAGGTGGGGGTGGGAGGG - Intergenic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1096154225 12:49332943-49332965 TTGAGAGCCTGGCGGTGGGGTGG - Exonic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096521303 12:52186210-52186232 CAGAGGGCCTGGTGATGGGAAGG - Intronic
1096552918 12:52385330-52385352 CTTTGGTGCTGGCTGTGGGATGG - Exonic
1097166475 12:57088993-57089015 CTGCCGGGCTGGCGGGCGGAGGG - Exonic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1099141226 12:78978011-78978033 CGGCGGGGCCGGCGGAGGGAAGG + Intronic
1100749251 12:97678937-97678959 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1100891597 12:99132029-99132051 CTGCTGGCCTGGGGGTGGGAAGG - Intronic
1101445734 12:104735735-104735757 CTGAGGGGCTGGCAGGGGCCAGG + Intronic
1101560939 12:105857394-105857416 TTCAGGGCCTGGGGGTGGGAGGG + Intergenic
1102177607 12:110887530-110887552 ATGAAGGAGTGGCGGTGGGATGG + Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102584089 12:113911039-113911061 CAGATGGGGTGGCGGTGGGGGGG + Intronic
1102690038 12:114753363-114753385 TCGAGGGGCTTGGGGTGGGAGGG - Intergenic
1102898855 12:116620494-116620516 ATGTGGGGTTGGCGGAGGGAAGG - Intergenic
1102950642 12:117028510-117028532 CTGCAGGGCTGGAGCTGGGAGGG - Exonic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1104198782 12:126567309-126567331 CTGTGGGGCAGGGGGTGGGTGGG - Intergenic
1104729180 12:131095552-131095574 CTGTGGGGCTGAGGGTGGGCCGG + Intronic
1104761504 12:131299777-131299799 CTGAGGGGCTGCGGGTGGGAAGG + Intergenic
1104818272 12:131661015-131661037 CTGAGGGGCTGCGGGTGGGAAGG - Intergenic
1105356971 13:19667523-19667545 GTCAGGGGCTGGGGGAGGGAGGG - Intronic
1105700895 13:22935223-22935245 CTGTGGGGCTTGGGGTGGGTGGG - Intergenic
1105853717 13:24358280-24358302 CTGTGGGGCTTGGGGTGGGTGGG - Intergenic
1106820527 13:33459256-33459278 CTTGGGTGCTGGAGGTGGGAGGG - Intergenic
1109078227 13:57865026-57865048 CTGTGGGGCGGGTGGTGGGGGGG + Intergenic
1109308051 13:60662168-60662190 CTGGGGGGGTGGGGGTGGCAGGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1113638397 13:111938117-111938139 CCGAGGGCCTGGAGGTGGGAAGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115345326 14:32336856-32336878 CTCAGGGGCTGCTGGTGGGGAGG - Intronic
1115823822 14:37241578-37241600 GTGAGGGGGTGGGGGTGGGGAGG + Intronic
1117987393 14:61400951-61400973 CTGAGGAGTTGGGGGTGGGGGGG + Intronic
1118003562 14:61545289-61545311 CACTGGGGCTGGTGGTGGGAAGG - Intronic
1118312573 14:64704561-64704583 CTGAGGGGCTGGCGGTGGGCGGG + Exonic
1118316712 14:64730232-64730254 CTGAGGAGCTGGCTGGGTGAGGG - Intronic
1118442088 14:65821430-65821452 CTGAGCAGCAGGCTGTGGGAAGG - Intergenic
1118532674 14:66724512-66724534 CTGAGGGGCTGGAGTGGGAAGGG + Intronic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1119385899 14:74258043-74258065 GCGAGGGGCTGCCGGGGGGAAGG + Intronic
1119736262 14:76984718-76984740 CTGAGGGGGTGCGGGTGGGGAGG - Intergenic
1120764440 14:88315865-88315887 TTGGGGGGATGGCGGTGGGGAGG + Intronic
1121016523 14:90552525-90552547 CTGAGAGCCTGGGGGTGGGCAGG - Intronic
1121260203 14:92560276-92560298 GTGAGTGGGTGGCAGTGGGAAGG - Intronic
1121408322 14:93732825-93732847 CGGCGGGGCTGGGGCTGGGAAGG + Intronic
1121410539 14:93745722-93745744 AGGAGGGGCTGGCAGGGGGATGG - Intronic
1121554897 14:94829109-94829131 CTGGGGGCCTGGAGCTGGGAGGG - Intergenic
1121834282 14:97077884-97077906 CGGAGAGGTTGGCGGTGGGCAGG + Intergenic
1122075304 14:99231606-99231628 GTGAGGGGCACGGGGTGGGACGG + Intronic
1122145338 14:99685307-99685329 CTGCGGGGGGGGCGGGGGGAGGG - Intronic
1122429996 14:101634611-101634633 CGGAGGGGCTTGTGGCGGGATGG + Intergenic
1122444689 14:101760766-101760788 GGGAGGGGCTGGCCGAGGGAAGG + Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122900007 14:104778523-104778545 CTGAGGGGCTGGGGTTGGGGTGG - Intronic
1123035519 14:105470276-105470298 CTGAGGGGCGGGCGGCGGGCTGG - Exonic
1123111343 14:105868350-105868372 GTGAGGGGCTGGCTCTGGGCTGG + Intergenic
1123941049 15:25216810-25216832 CTCAGGTGCTGGCTCTGGGAGGG + Intergenic
1123987528 15:25658602-25658624 CTGAAGGGCTGGCGGTGGGTGGG + Intergenic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124959098 15:34381927-34381949 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1124975724 15:34528148-34528170 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1125482332 15:40089196-40089218 CTGAGGGGGTGGAGGTCGGGGGG + Exonic
1127261190 15:57327336-57327358 CTGGGGGGCGGTCAGTGGGAGGG - Intergenic
1127289003 15:57553952-57553974 GTGGTGGGCTGGAGGTGGGAAGG + Intergenic
1127404751 15:58630959-58630981 CTGAAGGGTTGGAGGTGGGTGGG + Intronic
1127565827 15:60187280-60187302 ATGAGGGGCTGTTGGGGGGATGG - Intergenic
1127993658 15:64138849-64138871 TGGAGGGGCTGGAGGTGGCAAGG - Exonic
1128159677 15:65415373-65415395 CAGAGGGGCTGGCGGCTGGCTGG + Intronic
1128541479 15:68537641-68537663 CTGTGGGGGAGGCGGTGGGGAGG - Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128566073 15:68700986-68701008 CTGAGGAGCTGGGGGCGGGATGG + Intronic
1128579535 15:68799248-68799270 CTGAGGGGCTGCTGGAAGGAAGG + Intronic
1128745544 15:70111703-70111725 CCCAGGGGCTGGGGGTGGGCTGG + Intergenic
1128756119 15:70185201-70185223 CAGAGGGGAAGGTGGTGGGAAGG + Intergenic
1129162732 15:73755762-73755784 GCCAGGGGCTGGCGGGGGGAGGG - Intergenic
1129252054 15:74314573-74314595 CTAGGGGGCTGGCAGGGGGAGGG - Intronic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1129656174 15:77527019-77527041 CTCAGGGGCTCGAGCTGGGAAGG - Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130758770 15:86795527-86795549 CTGAGGGGCTGGATGAGGAAGGG - Intronic
1130979481 15:88803155-88803177 CTCCGGGGCTGGCGGGAGGAAGG - Intergenic
1131347806 15:91667089-91667111 CTGAGGGCCTGTCTGTGAGATGG + Intergenic
1131509803 15:93043758-93043780 CAGAGGGGCTGCCGATGGGTGGG + Intronic
1131915410 15:97259992-97260014 CTGAGAGCCTGGAGGTGGGCAGG + Intergenic
1132229109 15:100168811-100168833 TTGCGGGGCTGGGGATGGGAAGG - Intronic
1132376695 15:101332780-101332802 CTGTGGAGCTGTCGGTGGGGCGG - Intronic
1132644923 16:994353-994375 GTGAGTGGCTGGTGGTTGGATGG - Intergenic
1132696979 16:1206381-1206403 CTCTGGGGCTGCTGGTGGGAGGG - Intronic
1132729996 16:1356484-1356506 CTGAGGGCCAGGCGGAGGGGAGG + Intronic
1132986704 16:2771075-2771097 CTGGGGGGTTTGGGGTGGGAGGG + Exonic
1133013949 16:2930398-2930420 CTGAGGGGCTGCTGGGGGAACGG - Exonic
1133246489 16:4452327-4452349 CTGATGGGCGGGAGGAGGGAAGG - Intronic
1133767463 16:8848059-8848081 CTAGGGGGCTGGGGGTGGGTGGG - Exonic
1133768486 16:8854347-8854369 CTGGGGTGGTGGTGGTGGGAAGG - Exonic
1133984346 16:10656846-10656868 CTCAGGAGGTGGAGGTGGGAGGG - Intronic
1135347700 16:21703264-21703286 ACCAGGGGCTGGAGGTGGGAAGG - Intronic
1135821809 16:25692153-25692175 CTGAGGGGGGGGCGGTGGTGGGG + Exonic
1136071841 16:27792049-27792071 CTGAGGGGTGGGTGGTGGAAGGG - Intronic
1136091764 16:27925750-27925772 CCGAGGGGCTGGGGGTGACAAGG + Intronic
1137441692 16:48503803-48503825 CTGAGAGGCTGGCAGGGGGATGG + Intergenic
1137571458 16:49568909-49568931 TTAAAGGTCTGGCGGTGGGAAGG - Intronic
1137751224 16:50862557-50862579 CTGGGGTGTTGGCTGTGGGAAGG + Intergenic
1138098534 16:54232742-54232764 CTGAGGGGCTTGCTGGGGCATGG + Intergenic
1138105913 16:54287067-54287089 CGGAGGGGCGGGAGGCGGGAGGG - Intergenic
1138536730 16:57664164-57664186 CTGGGGGGCTGAGGGAGGGAGGG - Exonic
1139513450 16:67440148-67440170 CTGAGGGGCTGCCTGGAGGATGG - Intronic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1140126086 16:72120078-72120100 CTGTGGAGGTGGCTGTGGGAAGG + Exonic
1140354771 16:74296545-74296567 TTGGGGGGGTGGCGGGGGGAGGG + Intergenic
1140810225 16:78569980-78570002 CTGAAGAGCTTGCAGTGGGATGG + Intronic
1141434271 16:83990448-83990470 CTGAGGGGAAAGGGGTGGGAGGG - Intronic
1141468979 16:84225768-84225790 CAGAGGGCCAGGCCGTGGGAGGG - Intronic
1141555723 16:84835491-84835513 CAGAGGGCCTGGGGGTGGGTCGG - Intronic
1141592170 16:85076640-85076662 CGGAGAGGATGGCTGTGGGAGGG - Intronic
1141660925 16:85441028-85441050 ACGAGGGGCTGGCGGGGAGATGG + Intergenic
1141731023 16:85822894-85822916 CCGAGGGGTTTGGGGTGGGAGGG + Intergenic
1141770630 16:86087650-86087672 CCGAGGGGGTGGCGGTTGGCAGG + Intergenic
1141920879 16:87134550-87134572 TTCAGGGGCTGGAGGAGGGAAGG + Intronic
1142764418 17:2057443-2057465 CGGCGGGGCCGGCGCTGGGAGGG - Exonic
1143466115 17:7137842-7137864 CAGAGAGGCTGGGGCTGGGAAGG - Intergenic
1143631901 17:8144526-8144548 CTGGGGGGATGGCACTGGGATGG - Intronic
1143638884 17:8184000-8184022 CTGAGGGGTTGTCAGTGGGATGG + Intergenic
1143658460 17:8310951-8310973 CTGAGGGGCAGGGGCTGGGGAGG + Intronic
1143669860 17:8389189-8389211 CTCAGGGGGTTGAGGTGGGAGGG - Intergenic
1143734462 17:8900741-8900763 CGGAGGTGCTGGCGGTGGTGAGG - Intronic
1144586772 17:16492040-16492062 CCGAGGGGCGGGCGGTTGGCGGG - Intronic
1144728518 17:17513686-17513708 CTGAGGGGCTGGTGCAGGGAGGG + Intronic
1144729110 17:17516681-17516703 CTGAGGGGCTGTGGCTGGGAAGG - Intronic
1145266542 17:21382375-21382397 CTGAGGGGATGGGGCTGGCAGGG + Intronic
1145735237 17:27225035-27225057 CTGAGGGCCTGATGGTGGGCAGG - Intergenic
1146003238 17:29144205-29144227 CTGAGGGGCTTGGGGTGGCCTGG - Intronic
1146006593 17:29164449-29164471 AAGAGGGGCTGGCAGTGGTAGGG - Intronic
1146165749 17:30587080-30587102 TTGAGGGCCTGGTGGTGGGCAGG + Intergenic
1146677652 17:34784629-34784651 CTGGGGTGCTGGCAGGGGGAAGG - Intergenic
1146750353 17:35373376-35373398 CGGAGGGGCTGGGGGTGGAGTGG - Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1147187852 17:38722263-38722285 GTGGGGGGCTGGCTCTGGGAAGG + Intronic
1147243456 17:39105763-39105785 CTGGGGGGATGGCAGTGGCAGGG - Intronic
1147333412 17:39712299-39712321 CTGAGGAGGTGGGGGTGGGTGGG - Intronic
1147384685 17:40074295-40074317 AAGGGGGGCGGGCGGTGGGAGGG - Exonic
1147556999 17:41486004-41486026 CTGAGTGGGAGGCGGTGGCAGGG - Intergenic
1147627104 17:41907390-41907412 CTGGGGGGAGGGCGGTGGGGAGG - Intronic
1147943371 17:44066132-44066154 GAGAGGGGGTGGTGGTGGGAGGG - Intronic
1147998850 17:44375986-44376008 CTGAAGGGGTGGTGGTGGCAGGG + Intronic
1148029669 17:44610695-44610717 CTGAAGGGCTCTGGGTGGGACGG + Intergenic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148489895 17:48016257-48016279 CCTTGGGGCTGGAGGTGGGAGGG + Intergenic
1148678619 17:49459708-49459730 CTGAGGGCTTGGCTGGGGGAGGG + Intronic
1148735508 17:49862694-49862716 CTGGGAGGCTGGCTGTGGGCTGG + Intergenic
1148757494 17:49981235-49981257 CCAAGGGGCTGGGAGTGGGAGGG - Intergenic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1149466581 17:56884621-56884643 CTGAAGAGCTGGGGGTGGGTGGG - Intergenic
1150239794 17:63622473-63622495 CTGAGGGACTGGCGGGCGGGCGG + Exonic
1150501813 17:65658366-65658388 CTGAGGTGATGGCTATGGGAAGG + Intronic
1150848990 17:68686803-68686825 CAGCGGGGCAGGGGGTGGGAGGG + Intergenic
1151816114 17:76472171-76472193 CTGAGGGGCAGGGGGTCGGCTGG + Intronic
1151921676 17:77161409-77161431 CCGCGGGGATGGGGGTGGGATGG + Intronic
1152097002 17:78278318-78278340 CTGAGGCCCTGGGGGTGGGCAGG - Intergenic
1152098215 17:78285245-78285267 GTCAGGGGCTGGGGGAGGGAAGG + Intergenic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152718659 17:81911745-81911767 CGGAGGTGGCGGCGGTGGGACGG - Intergenic
1152795511 17:82304321-82304343 CCCTGGGGCTGGGGGTGGGAAGG + Intergenic
1152844051 17:82588443-82588465 TTGGAGGGCTGGCGGTTGGAGGG + Intronic
1152844056 17:82588458-82588480 TTGGAGGGCTGGCGGTTGGAGGG + Intronic
1152945442 17:83195262-83195284 CTTAGGGGCTGGAGCGGGGAGGG + Intergenic
1153699091 18:7674438-7674460 TTGAAGGGCTGGTGGTGTGATGG + Intronic
1153774820 18:8443108-8443130 CTAAGGGGCTGGGGTGGGGATGG - Intergenic
1153825556 18:8871033-8871055 CTGAGTTTCTGGAGGTGGGAAGG - Intergenic
1153950357 18:10053245-10053267 CTGGGGTGCTGGGGGTGGGTAGG - Intergenic
1154026315 18:10710383-10710405 CTGTGGTGCTGGCAGTGGGGGGG - Intronic
1155963625 18:32016642-32016664 GTGGGGGGCAGGCGGTGGGGGGG - Intergenic
1156451112 18:37266922-37266944 CTGAGATGCTGGTGGTGGGGGGG + Intronic
1156793810 18:41014974-41014996 CTTGGGGGCTGGGAGTGGGATGG + Intergenic
1156865623 18:41885891-41885913 CAGAGAGGTTGGCAGTGGGAAGG + Intergenic
1157803956 18:50644298-50644320 CTGAGGGTCGGGGGATGGGAGGG + Intronic
1158412845 18:57222879-57222901 CTGAGCAGCTGGCTGTAGGATGG - Intergenic
1158652950 18:59303904-59303926 CTGGTGGCCAGGCGGTGGGAAGG - Intronic
1158783426 18:60679598-60679620 CTCAGGGGTTGGGGGTGGGATGG - Intergenic
1158960256 18:62582266-62582288 CTAAGGTGTTGGCCGTGGGAAGG + Intronic
1159995780 18:74962563-74962585 CTGAGGCGCAGGATGTGGGAAGG - Intronic
1160196056 18:76756553-76756575 CTTAGGGGCCTGAGGTGGGAAGG + Intergenic
1160572276 18:79826238-79826260 CCGAGGGCCTGGCTCTGGGAAGG + Intergenic
1160678857 19:404304-404326 CTGAGGGGGTGTGGGGGGGACGG + Intergenic
1160725429 19:616126-616148 CCGGGGGGCTGGCGGGGGGCGGG - Exonic
1160811834 19:1016193-1016215 ATGAGGGGTGGGCGGGGGGAGGG + Intronic
1160813874 19:1026637-1026659 CTGGCGGGCGGGCGGCGGGACGG - Exonic
1160818347 19:1046568-1046590 CTGAGGGTCTGGTGGGGGGGGGG + Intronic
1160895244 19:1399390-1399412 GTGTGGGCCTGGCTGTGGGATGG - Intronic
1161038164 19:2096719-2096741 CTGAGGGGCGGGTCGTGGGCGGG + Intronic
1161264839 19:3359465-3359487 CTGAGGCGCGGGCGGTGCGCGGG + Intergenic
1161478190 19:4497885-4497907 CTGAGGGGCTGGCGCCTGAAGGG - Intronic
1161488431 19:4548318-4548340 CTGAGGTGCTGGCATTGGGCCGG + Exonic
1161535454 19:4816437-4816459 CTGTGGGGAGGGCGGTGGGGGGG + Exonic
1161633318 19:5370446-5370468 GTGAGGGGCGGGGGGTGGGGTGG - Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1161683481 19:5692035-5692057 CAGAGGCGCTGGCCGTGGAACGG - Exonic
1161779288 19:6280145-6280167 CGGAGGGGCGGGAGGAGGGAGGG + Intergenic
1161798552 19:6402125-6402147 ATGAGGAGCTGGTGCTGGGAAGG + Intergenic
1161843506 19:6696546-6696568 CTGAGGGGCTGGCAGGGTAAGGG - Intronic
1161865935 19:6832234-6832256 CAGAGGGGCAGGGGCTGGGAAGG + Intronic
1162547051 19:11337144-11337166 CTGGGAGGCTGGCTGTGGGTTGG - Intronic
1163094787 19:15049229-15049251 CAGATGGGCTGGCTATGGGATGG + Intergenic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163158955 19:15453490-15453512 CGGAGAGGCTAGGGGTGGGATGG + Exonic
1163174253 19:15552912-15552934 CTGAGGGGAGGGAGGTGGTAAGG + Intergenic
1163304871 19:16471777-16471799 CTGAAGGGCTTGCGGCGGGCGGG - Intronic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163484539 19:17578018-17578040 GTGAGGGGCCGGCCGTGGTAGGG - Exonic
1163530757 19:17847664-17847686 CTGCGGGGTTGGGGGTGGGGAGG - Intronic
1163579844 19:18131846-18131868 CTAAGGGGCGGGCGGGGGGCGGG + Intronic
1163757135 19:19112717-19112739 CTGAGGGCCTGGCTGTGTGCAGG - Exonic
1163982492 19:20914182-20914204 ATGAGGGGCTGACGGTGAAAAGG - Intergenic
1164137348 19:22427187-22427209 CTAAGGGGGTGGCGGGGGGGGGG + Intronic
1164320148 19:24137288-24137310 CAGAGGGACTGGTGGTGGGTGGG + Intergenic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165073536 19:33268840-33268862 CTGAAGGCCTGGCGGGGGGCTGG + Intergenic
1165090996 19:33388375-33388397 CTGTGGGGCTGGCTGAGGGTTGG + Intronic
1165219938 19:34307215-34307237 CTGAAGGGCAGGGGATGGGAGGG + Intronic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1165427246 19:35752964-35752986 ATGATGGGCTGGCTGAGGGAGGG + Exonic
1165438085 19:35807632-35807654 GTAAAGGGCTGGAGGTGGGAAGG - Intronic
1165713438 19:38028312-38028334 GTGAGGGGCAAGCGGTGGCAGGG - Intronic
1166176375 19:41074476-41074498 CTCAGGGGCGGGAGGGGGGATGG - Intergenic
1166211098 19:41306927-41306949 CTGAGGGGCTGGAGCAGGGTTGG - Exonic
1166304279 19:41928737-41928759 CTGAGGGAGTGGGGGTGGGGCGG + Intronic
1166354374 19:42218231-42218253 CTGCGGGGGTGGTGGTGGGGGGG - Intronic
1166360721 19:42251929-42251951 CTGAGGGGCTGGTGGAAGGCTGG - Intronic
1166361744 19:42255336-42255358 AGGAGGGGGTGGGGGTGGGATGG + Intergenic
1166519436 19:43470554-43470576 CTGGGAGGCGGGCGGAGGGAGGG - Intergenic
1166679740 19:44759185-44759207 AGGAGGGGCTGGGGGTGTGAGGG - Intronic
1166840261 19:45692879-45692901 CTGAGGAGCTGCCGCTGGGCCGG + Exonic
1166966093 19:46530120-46530142 CTAAGGAGCTGGGGGTGGAAGGG - Intronic
1167007313 19:46784475-46784497 CTGAGGGGATGGGGGTGGACAGG - Intronic
1167166680 19:47803666-47803688 GGGAGGGCCTGGGGGTGGGAGGG + Exonic
1167175157 19:47860098-47860120 GGGAGGGCCTGGGGGTGGGAGGG - Intergenic
1167564383 19:50247125-50247147 AGGCGGGGCTGGCGGTGGGCAGG + Intronic
1167633334 19:50639259-50639281 CTGGGGGCCCGGAGGTGGGAGGG - Intronic
1167689215 19:50975139-50975161 AGGAGGGGCTGGCGGGGGGGGGG + Intergenic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1168056747 19:53868702-53868724 CTGAGGGGCTGGGTGTGGCCCGG + Intronic
1168123822 19:54271891-54271913 AAGCGGGGCTGGGGGTGGGAGGG - Intronic
1168178535 19:54643644-54643666 AAGCGGGGCTGGGGGTGGGAGGG + Intronic
1168199393 19:54804017-54804039 CTGATGGGCTGACCATGGGAAGG + Intronic
1168275242 19:55274350-55274372 CAGGGGTGCTGGCGGTGGGGGGG - Intronic
925483032 2:4297657-4297679 TGGAGGGGCTGGAGCTGGGATGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
925927646 2:8681800-8681822 GTGCGGGGCTGGCGGGGGGCGGG - Intronic
925948308 2:8887256-8887278 TTGAGGGGGTGGTGGAGGGAAGG - Intronic
926108249 2:10165903-10165925 CTGAGGAGCTGGGGATGGGCAGG + Intronic
926251378 2:11157079-11157101 CCTAGGGGCTGGCGGCAGGAGGG - Intronic
926311163 2:11677280-11677302 CTGAGGAGCTGGAGTGGGGAGGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926886605 2:17604264-17604286 CAGAGGAGCAGGCGGTGGGCAGG + Intronic
926891055 2:17639090-17639112 CTAAGGGGCTGGTGGGGTGAAGG + Intronic
926978865 2:18545135-18545157 TTGAAGGGCTGGGGGTGGGTTGG - Intergenic
927475434 2:23410957-23410979 ATGAGGGGCTGGGGGAGGAAGGG - Intronic
927554395 2:24022089-24022111 CAGAGGGGCTGGTGCCGGGAGGG + Intronic
927631207 2:24775705-24775727 TTGAGGTGCTGGAGGTGGGAGGG - Intergenic
927673423 2:25088267-25088289 CTGAGGTTCTGGCTTTGGGAAGG + Intronic
927703521 2:25283003-25283025 CTCAGTGAGTGGCGGTGGGATGG - Intronic
927928155 2:27027118-27027140 CCGAGGGGCAGGGGGTGGGGAGG - Exonic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930641567 2:53859473-53859495 GTGAGGGGCTGGCGGTGGGTAGG + Intronic
930741042 2:54832740-54832762 ATGAGGGGTTGGCGGGGGGGTGG - Intronic
930924304 2:56797945-56797967 CTGAGGAGGTAGCGGTGGGGGGG - Intergenic
930981750 2:57534331-57534353 TTGAGGGGCTGGGGGAGTGAGGG - Intergenic
932056560 2:68449113-68449135 CTGCGGGGCTGGCGTTGTGCGGG - Intergenic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932492044 2:72128441-72128463 TTGAGGGGCTGTGGGTGGGGAGG - Intergenic
934650032 2:96085419-96085441 CTGAGGGGCAGGGGTGGGGATGG + Intergenic
934977659 2:98816032-98816054 CATAGGGGCTGGTGGTGGGGGGG + Intronic
935422778 2:102887035-102887057 CTGAGGGGAGGGGGGAGGGAGGG - Intergenic
935736679 2:106111930-106111952 CCGGGGAGCTGGGGGTGGGAGGG + Intronic
935781972 2:106516183-106516205 GTGAGATGCTGGCGGTGGGGTGG - Intergenic
936472530 2:112811701-112811723 CTGATGGGCTGGGGGTTGGAAGG + Intergenic
937032635 2:118753237-118753259 CTGAGGGGCGGGCATCGGGACGG - Intergenic
937279856 2:120710361-120710383 CAGAGGGGCCGGAGGTGGGCAGG - Intergenic
937905406 2:127050555-127050577 GTGCAGGGCTGGAGGTGGGACGG - Intronic
938166145 2:129028672-129028694 CAGAGGGGCTGGCAGTGAGAGGG + Intergenic
938199488 2:129361667-129361689 GGGAGGGGCTGGGGGTGGAAGGG - Intergenic
938288748 2:130138446-130138468 GTGCGGGCCTGGCGGTGGGTGGG + Intergenic
938467785 2:131534486-131534508 GTGCGGGCCTGGCGGTGGGTGGG - Intergenic
938902156 2:135807459-135807481 TTGAGGAGCTGGCAGTGGGTTGG - Intronic
939187559 2:138878606-138878628 CTGAGATGCTGGCAGTAGGAAGG + Intergenic
939715420 2:145578087-145578109 ACCAGGGGCTGGAGGTGGGACGG - Intergenic
942744664 2:179217984-179218006 TTGCGGGGCTGGGGGAGGGATGG + Intronic
943521016 2:188949399-188949421 ATGAGGAGCTGGAAGTGGGAAGG - Intergenic
945023793 2:205600651-205600673 CTGTCGGGGTGGCAGTGGGAGGG - Intronic
945627865 2:212234119-212234141 TTGAGGGGCTAGGGGAGGGATGG - Intronic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
946343649 2:219089929-219089951 CTGAGAGACTGGAGGTGGCATGG + Intronic
946360429 2:219216303-219216325 CTGAGGGAATGCCTGTGGGAGGG + Intronic
946543052 2:220706946-220706968 CAGAGGGGCTGGCTGTGTGTAGG - Intergenic
947727340 2:232408655-232408677 CTGGCAGGCTGGGGGTGGGAGGG - Intronic
948002729 2:234581606-234581628 CTGAGGGGCTGGGGACGGGGAGG - Intergenic
948058338 2:235026097-235026119 CAGAGGGGATGGGGGAGGGATGG + Intronic
948154138 2:235767687-235767709 CTGTGGGGTTGGCAGTGGGCTGG + Intronic
948617166 2:239206984-239207006 CTGAGAGGCTGGGGATGGGAGGG + Intronic
948839679 2:240642793-240642815 CTGGGGGGCGGCAGGTGGGAGGG - Intergenic
1168840070 20:904289-904311 CTGAAGGGCAGGTGGTGGGATGG - Intronic
1169186870 20:3625690-3625712 CTTGGGGGCAGGAGGTGGGAAGG - Intronic
1169258173 20:4114803-4114825 CTGTGGTGTTGGGGGTGGGAGGG - Intergenic
1169276202 20:4235250-4235272 CTGAGGGGCAGGTGAAGGGAGGG + Intronic
1169821017 20:9710152-9710174 CTGAGAGGCAGCCTGTGGGAAGG - Intronic
1171093229 20:22306000-22306022 CTGAGGGGCTGGAGCGGGAAAGG + Intergenic
1172122054 20:32604232-32604254 CTGAGGAGCTGGCTGTCGGGAGG - Intronic
1172176085 20:32972706-32972728 CTGGGGGTCTGGGTGTGGGATGG + Intergenic
1172441721 20:34970895-34970917 CAGACTGGCTGGGGGTGGGAGGG + Intergenic
1172638806 20:36428566-36428588 CTGAGGGGCAGAGGGTGGGGAGG - Intronic
1172777306 20:37415146-37415168 CTCAGGGGATGGAGGTGGGGTGG - Intergenic
1173605366 20:44327351-44327373 CTTGGGGGATGGGGGTGGGAAGG - Intergenic
1173941321 20:46913686-46913708 CTGAGGGATTGGCTCTGGGAAGG + Intronic
1174180028 20:48668817-48668839 GTGAGGGGCCGGCAGTGGGGAGG + Intronic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1174899050 20:54479374-54479396 TTGAGGGGCTGGGGGAAGGAGGG + Intronic
1175224943 20:57439370-57439392 CAGAGGGGTCGGGGGTGGGAGGG - Intergenic
1175371572 20:58496236-58496258 CAGAGGGGCTCGCAGTGGGCAGG + Intronic
1175772988 20:61635448-61635470 AAGAGGGGCTGGCAGAGGGAGGG + Intronic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175845596 20:62057165-62057187 CAGAGGTGCTGCCGGTGGCAAGG - Intronic
1175903293 20:62368264-62368286 CCGAGGGGGTGGCGGCGGGGTGG + Intergenic
1175944271 20:62551448-62551470 CTGAGGTGCTGGTGGGGGGCAGG + Intronic
1176020224 20:62958950-62958972 TGGAGGGGCTGGCTCTGGGATGG - Intronic
1176047749 20:63101438-63101460 CTGATGGGCAGGCGCTGGGTGGG + Intergenic
1176233057 20:64041800-64041822 CTGAAGGGGTGGAGGTGGGCTGG - Intronic
1176257351 20:64159247-64159269 CTGAGGGTCTGGATGTGGTAGGG - Intronic
1176363150 21:6015761-6015783 TTGAGGTGCTGGGGGTGGGGAGG - Intergenic
1176703746 21:10093202-10093224 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1178304399 21:31479402-31479424 CGGAGGGGCGGGCGGATGGACGG + Intronic
1178450689 21:32696720-32696742 CTGAGGGGCTGGCAGGGAGTTGG - Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179472521 21:41620950-41620972 CTGAGGAGATGGCAGTGGGCAGG + Intergenic
1179600792 21:42476150-42476172 ATGAGGTGCTGCCAGTGGGAGGG - Intronic
1179760368 21:43522784-43522806 TTGAGGTGCTGGGGGTGGGGAGG + Intergenic
1179826281 21:43968217-43968239 CTGCAGGGCTGGGGGTGGGGTGG + Intronic
1179886659 21:44317018-44317040 CTGGGAGGCTGGTGCTGGGAGGG + Intronic
1180751776 22:18129703-18129725 CTGAGGGGCTGGTGTGGGAATGG - Intronic
1180974715 22:19842023-19842045 CTGATGAGCAGGAGGTGGGAGGG - Intronic
1181010062 22:20035045-20035067 CTGTGGGGCTGGAAGTGGGTTGG - Intronic
1181059642 22:20276200-20276222 CTTGGGGACTCGCGGTGGGATGG - Intronic
1181266041 22:21631507-21631529 CCGAGGGTCTGCAGGTGGGAAGG + Intergenic
1181601286 22:23953292-23953314 CTGAAGGGTTGGAGGTGGGTGGG + Intergenic
1181607224 22:23988045-23988067 CTGAAGGGTTGGAGGTGGGTGGG - Intergenic
1181672970 22:24434373-24434395 CTCAGGGGCTGGCTGTTGGAGGG + Intronic
1181793235 22:25283499-25283521 CTGAGGGGATGGAGTTGGAAAGG - Intergenic
1181865118 22:25848578-25848600 ATGATGGGCTGGCAGGGGGATGG + Intronic
1182353475 22:29711511-29711533 CTGAGCTGCTGCCGGGGGGATGG + Intergenic
1182355240 22:29719903-29719925 CTCAGGGGCCGGCGGCGGGAAGG + Intergenic
1182414185 22:30210445-30210467 CTCAGGGGCTGGCTCTGGGCAGG + Intergenic
1182561151 22:31160308-31160330 GTGAGGGGCTGGGGTTGGGGCGG + Intronic
1183029756 22:35094723-35094745 CTGAGCGGCTGGCTGGTGGAAGG - Intergenic
1183212710 22:36460793-36460815 CTGAGAGGCAAGTGGTGGGAAGG - Intergenic
1184262851 22:43329252-43329274 CCGCAGGGCTGGCAGTGGGAAGG + Intronic
1184424889 22:44403491-44403513 CCCAGGGGATGGCAGTGGGAGGG + Intergenic
1184671472 22:46014120-46014142 TTGAAGGTCTGGCGGTGGGAGGG - Intergenic
1184769669 22:46589861-46589883 CTGAGGGGCTGAGGGAGGGGAGG - Intronic
1184783551 22:46660874-46660896 TGGAGGGGCTGGGTGTGGGACGG + Intronic
1184910617 22:47531563-47531585 CTGAGAGGCTGGAGTGGGGAAGG + Intergenic
1185173886 22:49308201-49308223 CTGAGGGGCTGGGGAGGGGCGGG + Intergenic
1185245976 22:49772963-49772985 GGGCGGGGCTGGCTGTGGGAAGG + Intergenic
1185299447 22:50071974-50071996 CTGAGGGGCTGCCAGTGCAAAGG + Intronic
1185398706 22:50605158-50605180 CTGAGGGTCTGGCTGTGGTCAGG + Intronic
949254652 3:2031089-2031111 ATGAGGAGCTGGTGGTAGGAAGG + Intergenic
949814288 3:8041256-8041278 GAGAGGGACTGGCGGTGGGCAGG - Intergenic
950117047 3:10457872-10457894 CTAAGGGGCAGGCAGTGAGAGGG + Intronic
950219532 3:11183957-11183979 CAGAGAGGCAGGCGGTGTGATGG + Intronic
950627511 3:14259079-14259101 CTGCGGGGCTGGTGGAGGCAAGG - Intergenic
950631240 3:14283519-14283541 CTCGGAGGCTGGTGGTGGGAAGG - Intergenic
950771867 3:15318240-15318262 CTAAGGGGCTGGAGGAGGAAAGG + Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952217608 3:31293426-31293448 CTGAAGGAATGGAGGTGGGATGG - Intergenic
952508992 3:34035410-34035432 CTGAGGGGCTGGGGCTGGCTGGG + Intergenic
953610432 3:44443184-44443206 CTGGGGGGCTGGCATGGGGAAGG + Exonic
953891642 3:46755796-46755818 CTGAGGGGATGTGGTTGGGAGGG - Intronic
954212510 3:49105970-49105992 ATGAGCAGCTGGTGGTGGGATGG + Intergenic
954656229 3:52195914-52195936 CTGTGGGGGTGGCGGTTGGGGGG - Intergenic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
956231864 3:67026227-67026249 TTGAAGGGGTGGGGGTGGGAGGG - Intergenic
958060697 3:88476247-88476269 CTGTGGGGGCGGGGGTGGGATGG - Intergenic
961260143 3:125595514-125595536 CTGTGGGGCTGTGGGTGGGGCGG - Intergenic
961391195 3:126553201-126553223 CTGTGGGGCTGCAGCTGGGAGGG - Intronic
961491262 3:127258075-127258097 CTCAGGGCCTGGGGGTGGGCTGG - Intergenic
961738242 3:129015635-129015657 AGCAGGGGATGGCGGTGGGAAGG - Intronic
961774963 3:129278334-129278356 CTGAGGGGCTGGGGCAGGAAAGG + Intergenic
963063241 3:141241751-141241773 CTCATGGGCTGGCTGTGAGAGGG + Intronic
963511148 3:146250951-146250973 CTGCGGGGCAGGCGGTGAGTGGG - Exonic
963942414 3:151108238-151108260 GTGAGGGGCAGGTGGTGGGTGGG + Intronic
964305317 3:155333434-155333456 CTGAGGGTCTGGAGCTGGGCCGG + Intergenic
964415431 3:156443193-156443215 TTGAGGGGGCGGCGGTGAGAGGG - Intronic
966172861 3:177101638-177101660 TTGAGGGGCCGCCTGTGGGAAGG - Intronic
966594129 3:181711407-181711429 CAGAGGGGCTGGAGTTGGGGGGG + Intergenic
966660767 3:182412063-182412085 CACAGGGGTTGGCAGTGGGACGG - Intergenic
967115329 3:186332438-186332460 CTGAGGGGCTGATGTAGGGAAGG + Intronic
967653347 3:192014495-192014517 CTCAGGAGGTGGAGGTGGGAGGG - Intergenic
967952752 3:194853413-194853435 CTGATGGGCTGTCTGTCGGACGG - Intergenic
968068087 3:195770071-195770093 GTGGGGGGGTGGCGGTGGGGGGG + Intronic
968079518 3:195836327-195836349 CTGAGGGGCTGGCTGTGTCTGGG - Intergenic
968204789 3:196789779-196789801 CTGTGGGGCTGACGGGGGGGTGG + Intronic
968455927 4:699801-699823 CTAAGGGGCTTGGGGTGGGTTGG + Intergenic
968805175 4:2767538-2767560 CTAGGGGGCTGGCTGGGGGAAGG - Intergenic
968956281 4:3721405-3721427 CCTGGGGGCTGGGGGTGGGAGGG + Intergenic
968957511 4:3726827-3726849 CTGAGGGGCTCACGGTGGATGGG - Intergenic
969112360 4:4851973-4851995 CTGAGGGACTGGGGAGGGGAGGG - Intergenic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
970559623 4:17269801-17269823 ATGAGAGCCTGGCAGTGGGAGGG - Intergenic
970590571 4:17556638-17556660 GTGAGGGACTGGGGGTGGGGAGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975212358 4:71716184-71716206 GTGAGGGGTTGGCGGGGGGCTGG - Intergenic
975288807 4:72651965-72651987 GTGAGGGGCTAGGGGAGGGATGG + Intergenic
975663420 4:76709553-76709575 GTTAGGGACTGGGGGTGGGAGGG + Intronic
975758802 4:77597832-77597854 CTTAGGTGCTGGTGGTGGGCAGG - Intronic
976969222 4:91083408-91083430 CCGGGGGGTTGGCGGGGGGAAGG + Intronic
978852225 4:113352929-113352951 CTGTGGTGGTGGTGGTGGGAGGG - Intronic
980375962 4:131949554-131949576 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
985670592 5:1204644-1204666 CTGAGGGGCCAGCTGTGGGGTGG - Intronic
985727410 5:1523555-1523577 CTGAGGGGCGGCCGCGGGGAGGG + Intronic
985938019 5:3111616-3111638 CTCAGGGGATGGGGGTGGGTGGG - Intergenic
985961348 5:3305605-3305627 GTGAGGGGCTGGGGGTGGGCAGG + Intergenic
986249529 5:6043969-6043991 CTGAGGGGCAGCTGGTGGGGTGG - Intergenic
986315955 5:6586467-6586489 CAGAGGGGCTTGCTGGGGGATGG - Intergenic
987296679 5:16559108-16559130 CGGAGGGGTTGGAGGTGGGAAGG - Intronic
987450544 5:18078296-18078318 CTGATGGGCTTGTGGTGGCAGGG + Intergenic
987855030 5:23410635-23410657 GTTAGGGGCTGGCAGGGGGAGGG - Intergenic
988379166 5:30478541-30478563 TTGAGGGGCTGGGGATGGGGTGG + Intergenic
988628326 5:32900954-32900976 CAGAGCAGCTGGGGGTGGGAGGG + Intergenic
988847365 5:35141802-35141824 ATGAGGAGTTGGGGGTGGGAGGG - Intronic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
989599961 5:43192129-43192151 GCGAGGGGCTGGCGTGGGGAAGG - Intronic
990115593 5:52386348-52386370 CTGAGGGGCTGGGAGGGGGCAGG + Intergenic
990210605 5:53479210-53479232 GGGAGGGTCTGGCGGGGGGAGGG + Intergenic
991478530 5:67050421-67050443 CTGAGGGGCAGGAGGTGAGCAGG - Intronic
991612452 5:68463496-68463518 CTGAGTGGATGGCGGAGGGATGG + Intergenic
991970192 5:72133343-72133365 GTGAGGCGCTGGAGGCGGGATGG + Intronic
992263876 5:74998032-74998054 CTGCAGGGCTGACTGTGGGATGG - Intergenic
994712347 5:103281035-103281057 CTAAGGGGTTGGAGCTGGGATGG + Intergenic
995021123 5:107368447-107368469 GGGAGGGGGTGGCAGTGGGAAGG - Intergenic
996532865 5:124544490-124544512 CTGAGGGGCTGAGGGTGAGTAGG - Intergenic
996875513 5:128236256-128236278 CTGAAGGGCTTACGGAGGGAGGG + Intergenic
997141414 5:131385044-131385066 TGGAGGGGGTGGAGGTGGGAGGG - Intronic
997594329 5:135096069-135096091 CTGAGGGGCTGCCTGGGGGTTGG + Intronic
997829133 5:137133943-137133965 CAGATGGGCTGGGGGTGGGGGGG + Intronic
998136672 5:139677698-139677720 CTCAGAGGCTGGGGGTGGGTGGG + Intronic
998159664 5:139806271-139806293 CAGCAGGGCTGGAGGTGGGAAGG + Intronic
998399477 5:141841097-141841119 CTGAGGGGTTGTAGGAGGGAGGG - Intergenic
998562323 5:143183213-143183235 CTGAGGGGCAAGAGGTGGGTTGG + Intronic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999367437 5:151032293-151032315 CTGTAGGCCTGGCTGTGGGAGGG + Exonic
999737516 5:154523777-154523799 CTGGGGGGCGGGCAGAGGGAGGG - Intergenic
1000210174 5:159100856-159100878 TTGAGGCGGGGGCGGTGGGATGG + Intergenic
1000679985 5:164171622-164171644 CTGGGGGGCTGGAGGTGGGGTGG - Intergenic
1001930044 5:175666321-175666343 GAGAGGGGCTGGGGGTGGCAGGG - Intronic
1001935437 5:175700221-175700243 CTTACAGGCTGGCGGTGAGAAGG + Intergenic
1002209973 5:177592692-177592714 CTGAGAGGCTGGCGGAGAGGAGG - Intronic
1002375998 5:178789553-178789575 CTCATGGGCTGGTAGTGGGAGGG - Intergenic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1003291807 6:4786143-4786165 CTAAGGAGGTGGAGGTGGGAGGG + Intronic
1005880908 6:30060270-30060292 CAGAGTGGATGGTGGTGGGAGGG + Intronic
1005904230 6:30247207-30247229 ATGAGGGGTTGGGAGTGGGAAGG - Intergenic
1006338236 6:33431974-33431996 CGGAGAGGCTGGCAGCGGGAAGG - Intronic
1006719847 6:36142986-36143008 CAGAGGAGCTGGCGGGGCGAGGG + Intronic
1006750748 6:36375349-36375371 GGGAGGGACTGGTGGTGGGAGGG - Intronic
1007210182 6:40187402-40187424 GTGAGGGGGTGGTGGTGGGGTGG + Intergenic
1007350073 6:41265886-41265908 GTGAGGGGATGGGGGTGGGGTGG + Intergenic
1007366727 6:41399336-41399358 GTTAGGGGCTGGGGGTGGGGTGG - Intergenic
1007397739 6:41587177-41587199 CTGTGGGGTTGGGGCTGGGAGGG - Intronic
1007769338 6:44180511-44180533 CTGTAGGGCTGGGGGTTGGAAGG + Intronic
1010716208 6:79233523-79233545 CACTGAGGCTGGCGGTGGGAGGG + Intronic
1010980361 6:82364085-82364107 CCGAGGGGCTGGCGGGGCGCGGG + Intronic
1011685421 6:89819817-89819839 CTGAGGGGCTGAGGCCGGGAGGG - Intergenic
1012056645 6:94420623-94420645 GTGAGGGGCTGGGGGAGGGATGG + Intergenic
1012287097 6:97403956-97403978 CTCAGGGGCCTGAGGTGGGAGGG - Intergenic
1014817641 6:125953107-125953129 CTGAGCTGCAGGCGGTGGCATGG + Intergenic
1016421348 6:143886786-143886808 TGGAGGGGGTGGAGGTGGGAGGG - Exonic
1017715844 6:157212421-157212443 TGGTGGGGCTGGAGGTGGGAGGG + Intergenic
1018182699 6:161238052-161238074 TTGGGGGGCTGGGGGTGGGGGGG + Intronic
1018697944 6:166405394-166405416 CTCAGGGGGTGAGGGTGGGAGGG - Intergenic
1019283620 7:212601-212623 GTGAGGGGCCGGCGGTGAGGTGG + Intronic
1019292742 7:258358-258380 CTGAGGTGCTGGAGATGGGCAGG + Intronic
1019475920 7:1244181-1244203 CTGGGGGGCTGGGTTTGGGATGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020080922 7:5285263-5285285 CTGGGGGGTTGGGGGTGGGGTGG - Intronic
1020151449 7:5684899-5684921 ATGGGGGGCTGGGGGTGGGGTGG + Intronic
1021432908 7:20581920-20581942 GTGAGGGGGTGGGGGAGGGAGGG + Intergenic
1021883622 7:25116987-25117009 CTGAGAGGCTGGCCGAGGAAGGG + Intergenic
1021896356 7:25239687-25239709 CTGGGGGGCGGGGGGTGGGGAGG + Intergenic
1021934869 7:25620358-25620380 CTGGGTGGCTGGCTGTGGGCTGG + Intergenic
1022188732 7:27996422-27996444 CTGAGAGGATGTGGGTGGGAAGG + Intronic
1022221965 7:28322583-28322605 GTGGGGGGCTGGGGGAGGGAGGG - Intronic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1023965462 7:44961418-44961440 CTGAGGGGCTGAGGGTTTGAGGG + Intergenic
1024229611 7:47354345-47354367 TTGGGGAGCTGGGGGTGGGAGGG - Intronic
1024255921 7:47539928-47539950 CTGAGGGTCTGGGGATGCGAAGG + Intronic
1025014477 7:55427864-55427886 CTGAGGGCCGGGGGCTGGGAAGG + Intronic
1025112406 7:56229836-56229858 CGGAGGGGCTGGGGCTGTGAGGG - Intergenic
1025197986 7:56946903-56946925 CTGAGGGGTTGGGGGTGGGGTGG + Intergenic
1025673961 7:63630032-63630054 CTGAGGGGTTGGGGGTGGGGTGG - Intergenic
1026902783 7:74046259-74046281 CAGAGGCTCTGGCGTTGGGAGGG + Intronic
1026911662 7:74094821-74094843 CGGAGGTGGTGGCGGTGGCAGGG - Intronic
1027151677 7:75738309-75738331 CTAAGGGGTGGGGGGTGGGAAGG + Intronic
1027246816 7:76373254-76373276 GTTAGGGGGTGGAGGTGGGAGGG + Intergenic
1027260643 7:76462127-76462149 CTGAGGGGCTCGCAGGCGGAGGG + Intronic
1027312022 7:76960240-76960262 CTGAGGGGCTCGCAGGCGGAGGG + Intergenic
1029220784 7:98988592-98988614 CCCAGGGGCTGGAGGTGGGAGGG + Intronic
1029502431 7:100940745-100940767 CTGGCGGGCTGGGGGAGGGATGG - Intergenic
1029544425 7:101202747-101202769 CTGGGAGGCTTGAGGTGGGAGGG - Intergenic
1029548597 7:101224290-101224312 CAGAGGGGCGGACGGTGGCAGGG - Intergenic
1030219409 7:107081399-107081421 CTGATGGGGTGGGGGTGGGAGGG - Intronic
1031522704 7:122785832-122785854 GTGTGGGGCTTGAGGTGGGAGGG - Intronic
1031731430 7:125306633-125306655 TTGGGGGGATGGCGGTGGAAGGG + Intergenic
1031761224 7:125715839-125715861 GAGAGGGACTGGCAGTGGGAGGG + Intergenic
1032002014 7:128271690-128271712 CCGCGGGGCTGGTGGTGGGAGGG + Intergenic
1032016217 7:128381822-128381844 GTGAGGGCCTGGCGGGGGGTGGG - Intergenic
1032086435 7:128886383-128886405 CTGAGGGGAGGGAGGTGGGGTGG + Intronic
1032870161 7:135976928-135976950 CTGCGGGGATGGGGGTGGGCGGG - Intronic
1033210892 7:139459553-139459575 CTGAGGTGTTGGCGTTGAGATGG - Intronic
1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG + Intronic
1033255486 7:139797673-139797695 GTGAGGGGCTGGGAGTGGGATGG + Intronic
1033268792 7:139912161-139912183 CTGGGAGGCTGGGAGTGGGAGGG + Intronic
1033428966 7:141271199-141271221 CTGAGAGGCTGGAGTTGGGGTGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034460503 7:151195547-151195569 ATGAGGGGCTGGGGCTGGGCAGG - Intronic
1034540466 7:151754952-151754974 CTGAGAGGCAGGCTCTGGGATGG + Intronic
1034637905 7:152581891-152581913 CTGAGAGCGTGGTGGTGGGATGG - Intergenic
1035192485 7:157183495-157183517 CCAAGGGGCTGTCTGTGGGAGGG - Intronic
1035241623 7:157534303-157534325 GTGAGGGGCTGGAGTAGGGAGGG - Intergenic
1035479102 7:159167668-159167690 CTGAGGGGCTGTGGGCAGGATGG + Intergenic
1035516044 8:232809-232831 CGTAGGGCCTGGCGGAGGGAAGG - Intronic
1035555122 8:562274-562296 CTGAGGGGCTGGGGTGGGAAGGG + Intergenic
1036210169 8:6834939-6834961 CAGAAGGGGTGGCGGGGGGAGGG - Intronic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036644073 8:10601281-10601303 CTGAGGGGCTGGCCCTGGCTGGG + Intergenic
1036935932 8:13002928-13002950 CTGAGGAGCTGGGGAAGGGAGGG - Intronic
1037573519 8:20179261-20179283 TTCAGTGGCTGGAGGTGGGATGG + Exonic
1037759026 8:21729752-21729774 CTTTGGGGGTGGCGGTGGGAGGG - Intronic
1037818310 8:22123622-22123644 GAGAGGGGCTGGGGGTGGGAGGG - Intronic
1037877285 8:22554349-22554371 AGGAGGGGCCGGCTGTGGGAGGG - Intronic
1037883124 8:22582430-22582452 CTGAGGGTCTGGCAGCGGAAGGG + Intronic
1037884681 8:22589750-22589772 CTGGGGGGCTGGGGAGGGGAAGG + Intronic
1038082447 8:24154330-24154352 CCCAGGGGCTGGCGTGGGGAGGG + Intergenic
1038185697 8:25272869-25272891 CTGAGGGGCTTGCGGGGGATAGG - Intronic
1038805706 8:30789365-30789387 CTGAGGGGCTGTCTCTGGGTAGG + Intronic
1039839992 8:41286352-41286374 CGGCGGGGGAGGCGGTGGGAAGG - Intronic
1039850205 8:41358280-41358302 CTGAGGGGCTGAAGTGGGGAAGG + Intergenic
1039882324 8:41632687-41632709 CTTCTGGGCTGGCGGAGGGAAGG + Intergenic
1040387622 8:46924228-46924250 CAGAGGGGTGGGTGGTGGGATGG - Intergenic
1041264706 8:56053083-56053105 CTGAGTTGCTGACGGAGGGAAGG - Intergenic
1041986970 8:63933380-63933402 CACAGGGGCTGGAGGGGGGAAGG - Intergenic
1042062083 8:64830541-64830563 ATGAAGGGTTGGGGGTGGGAGGG - Intergenic
1042533274 8:69835126-69835148 CGGGGTGGCTGGCTGTGGGAGGG - Intergenic
1045188394 8:99860264-99860286 GTGAGGGACTGTGGGTGGGAGGG + Intronic
1046131874 8:109975579-109975601 GTGAGGAGGTGGGGGTGGGAGGG + Intronic
1048251020 8:132866884-132866906 CTGAGGACCTGGGGGTGGGAAGG + Intergenic
1049001115 8:139826155-139826177 CAGAGGGGCAGGCTGTGAGAGGG + Intronic
1049109966 8:140636086-140636108 CCGAGGGGCTGAGGGTGGGAGGG - Intergenic
1049401082 8:142427664-142427686 CCGAGGGCCTGGGGGTGGGAGGG - Intergenic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049466168 8:142752200-142752222 GAGAGGGGCTGGCGGTGAGGGGG - Intronic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049635774 8:143688368-143688390 CTGCTGTGCTGGAGGTGGGAGGG + Intronic
1049725337 8:144143128-144143150 TTGAGGGGCTGGCTGTGGTAGGG + Intergenic
1049782490 8:144435313-144435335 CAGAGGGGCTGGTGGTGTGCTGG - Intronic
1049989234 9:976574-976596 GGGCGGGGGTGGCGGTGGGAAGG + Intergenic
1049993658 9:1013968-1013990 TGGAGGGGCTGGCAGTAGGAAGG - Intergenic
1050271172 9:3946993-3947015 GTGAGGGGTTGGCTGTAGGATGG - Intronic
1050271181 9:3947035-3947057 CTGAGAGGTTGGCTGTAGGATGG - Intronic
1051580621 9:18669913-18669935 CTGAGAGGCTGGGAGTTGGAAGG - Intronic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1052997257 9:34557792-34557814 CAGAGGGCATGGTGGTGGGATGG + Intronic
1053641012 9:40080222-40080244 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1053765124 9:41385246-41385268 CAGAGGGAGTGGGGGTGGGAGGG - Intergenic
1054321756 9:63676518-63676540 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1054543740 9:66296408-66296430 CAGAGGGAGTGGGGGTGGGAGGG - Intergenic
1054754792 9:68946741-68946763 CTGAGGTGGTGGGGGTAGGAAGG - Intronic
1056064831 9:82923379-82923401 TGGAGGGGGTGGGGGTGGGAAGG - Intergenic
1056322702 9:85451923-85451945 GAGAGGGACTGGCGGTGGGTGGG + Intergenic
1056565553 9:87769845-87769867 CTGCAGGGCTGGGCGTGGGAGGG - Intergenic
1056604536 9:88076133-88076155 CAGAAGGGCGGGAGGTGGGAGGG - Intergenic
1056722089 9:89081453-89081475 CTCAGGGTGTGGGGGTGGGAGGG - Intronic
1056759489 9:89404925-89404947 GTGGGTGGCTGGCGATGGGATGG - Intronic
1057196992 9:93120875-93120897 ATGAGGGGCTGGGGCTGGGAGGG + Intergenic
1057211808 9:93204588-93204610 CTGAGGGGCAGGGGTGGGGAAGG + Intronic
1057739759 9:97701156-97701178 AGGAGGGGATGGTGGTGGGAGGG - Intergenic
1057887103 9:98838293-98838315 CTGTTAGGCTGGCGGTGGGGGGG - Intronic
1058910072 9:109512895-109512917 CTTAGGGGCAGGAGGAGGGAGGG - Intergenic
1059061401 9:111038267-111038289 CCGAGGGGCGGGCGGAGGGCCGG - Intronic
1059719613 9:116946728-116946750 CTTGGGGGCTTGAGGTGGGAAGG + Intronic
1059878813 9:118667295-118667317 CTGATGGGGTGGGGGTGGGTGGG - Intergenic
1059941248 9:119362048-119362070 CGGAGGGGTTGGGGGTGGGGGGG - Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060521793 9:124298227-124298249 CTGAGGGGAAGGAGGTGGGGAGG - Intronic
1060814318 9:126626773-126626795 CCGCGGGGCTGGGGGTGGGGCGG - Intronic
1060831884 9:126722554-126722576 CAGCGGGGTGGGCGGTGGGAGGG - Intergenic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1061492626 9:130954486-130954508 CTAAGGGTGTGGTGGTGGGAAGG - Intergenic
1061652176 9:132059572-132059594 CTGAGGGGCGGGCCGAGGGAGGG + Intronic
1061671033 9:132188269-132188291 CTGAGGGGCTGAGGATGAGAAGG + Intronic
1061814860 9:133188582-133188604 CTGGGGGCCTGGCGGCTGGAAGG + Intergenic
1062031337 9:134363365-134363387 CTGAGCAGCGGGAGGTGGGAAGG + Intronic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062286977 9:135777730-135777752 CAGAGGAGCTGGGGGTGGGGAGG - Intronic
1062528360 9:136987813-136987835 GTGAGGGGCTGGCAGCAGGACGG - Intergenic
1062574455 9:137199921-137199943 CTGGGGGGCGGGTGGAGGGAGGG + Exonic
1062617235 9:137403406-137403428 CTGCTGGGCTGGGGGTGGGGAGG - Intronic
1202788783 9_KI270719v1_random:63297-63319 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1185533292 X:839029-839051 CTGGGGGGGTGGGGGTGGGGGGG + Intergenic
1185665086 X:1759309-1759331 CAGAGGAGCTGGGGGTGGGTGGG + Intergenic
1185791069 X:2928671-2928693 CTGGGGGGTTGGGGGCGGGACGG + Intronic
1185836239 X:3347326-3347348 CTGGGGAGGGGGCGGTGGGAGGG + Intergenic
1186485653 X:9932561-9932583 CGCAGGGGATGGCGTTGGGAAGG - Exonic
1186638041 X:11427421-11427443 CTGAGGGGGTGGCGGGTGGCCGG - Intronic
1186765632 X:12767962-12767984 CACAGGGGCTGGGGGTGGGGAGG + Intergenic
1187266278 X:17737211-17737233 CTGAGGAGATGGCTGTGGGGCGG - Intergenic
1187770396 X:22689529-22689551 CTGAAGGGGTGGGGGAGGGAGGG - Intergenic
1187772284 X:22713218-22713240 CTGGAGGGCTGGCAGTGGGAAGG + Intergenic
1188927482 X:36062690-36062712 TTCAGGGGCTGGGGGTGGGGTGG + Intronic
1190105314 X:47556450-47556472 CTGAGAGGACGGCGGTGGGAGGG + Intergenic
1190441101 X:50475063-50475085 CTGGGGGGCTGGGGGTGGGTGGG + Intergenic
1191736582 X:64394603-64394625 GAAAGGGGCTGGCGTTGGGAAGG + Intronic
1192874138 X:75210651-75210673 AGGAGGGGATGGTGGTGGGAGGG + Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195688525 X:107605534-107605556 CTGAAGGGCTGGAGGTGGTGTGG + Intergenic
1195988889 X:110662892-110662914 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1196172115 X:112600565-112600587 CTGGGGGGCTGTGTGTGGGAAGG + Intergenic
1196700646 X:118664182-118664204 CTGATTTGCTGGCTGTGGGAGGG + Intronic
1198217627 X:134570287-134570309 CTGAGGGGTTAGAGATGGGAAGG + Intronic
1198807452 X:140505370-140505392 CTGAGGAGGTGACGGGGGGAGGG + Exonic
1199085498 X:143624490-143624512 CAAAGGGGCTGCCAGTGGGAAGG + Exonic
1199661573 X:150055481-150055503 CTGGGGTGCTAGCGGTGGTAGGG - Intergenic
1199852555 X:151736119-151736141 CTGAGGGGCTGGGTGAGTGAAGG - Intergenic
1199985058 X:152944517-152944539 GTGTGGGGCTGGTGATGGGAGGG + Intronic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200210155 X:154343547-154343569 CTGAGGGACAGGCTCTGGGAGGG + Intergenic
1200220697 X:154388545-154388567 CTGAGGGACAGGCTCTGGGAGGG - Intergenic
1201076314 Y:10192348-10192370 TTGAGGGGAGGGAGGTGGGAGGG - Intergenic