ID: 1103951690

View in Genome Browser
Species Human (GRCh38)
Location 12:124554885-124554907
Sequence AGCCTTCGAGGGTGACCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103951682_1103951690 7 Left 1103951682 12:124554855-124554877 CCTGCACAGCAGAGCTGGCCGCA 0: 1
1: 0
2: 2
3: 16
4: 202
Right 1103951690 12:124554885-124554907 AGCCTTCGAGGGTGACCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1103951680_1103951690 29 Left 1103951680 12:124554833-124554855 CCAAGACAGACAGGGTCAGCTTC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1103951690 12:124554885-124554907 AGCCTTCGAGGGTGACCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103951690 Original CRISPR AGCCTTCGAGGGTGACCCGG AGG Intronic
900167796 1:1250801-1250823 ATCCTTGGTGGGTGACCCAGAGG - Intergenic
901459423 1:9382860-9382882 TGCCTCCGAGGGTGACCCATGGG - Intergenic
901849203 1:12004741-12004763 AGCCTTCTGGGGTCACCTGGTGG + Intronic
907269344 1:53281492-53281514 AGCCTTCCAGGGTGTGCAGGAGG + Intronic
908356738 1:63329961-63329983 AGCCCTCGAGGTTGGCACGGGGG - Intergenic
913344566 1:117795356-117795378 AGCCTGGGAGGTTGGCCCGGGGG + Intergenic
921167159 1:212515288-212515310 TTCCTCCGAGGGTGACCCTGGGG + Intergenic
922769733 1:228175444-228175466 AGCCTCTGAGGGTGCCCAGGTGG + Exonic
1062898104 10:1120367-1120389 CGCCTCCGAGGGGCACCCGGGGG + Intronic
1064408901 10:15088605-15088627 AGCGGTCGGCGGTGACCCGGGGG - Intronic
1069654232 10:70075879-70075901 AGCCTGCGAGGGGGACCCAGGGG - Intronic
1071513706 10:86283149-86283171 AGCCTTGGAGGATGAGCTGGAGG - Intronic
1072555505 10:96511639-96511661 AGCCTTGGAGGATAACCCTGAGG - Intronic
1072799442 10:98382992-98383014 GGCCTTTGAGGGTGACTCTGTGG + Intergenic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1089207113 11:116773105-116773127 AGCCTGCGAGCGCGTCCCGGTGG - Intergenic
1089346610 11:117795551-117795573 AGCCTTGGTGTGTAACCCGGGGG + Intronic
1096601945 12:52735821-52735843 AGCATTGGAGGGAGACCTGGTGG - Intergenic
1103951690 12:124554885-124554907 AGCCTTCGAGGGTGACCCGGAGG + Intronic
1114519120 14:23321778-23321800 ACTGGTCGAGGGTGACCCGGGGG + Exonic
1124016729 15:25883248-25883270 AGAATTCAAGGGTGAACCGGTGG - Intergenic
1125535459 15:40439492-40439514 AGCCTTGGAGTGTGGCCCAGGGG - Intergenic
1128617429 15:69121161-69121183 AGGCTTCTAGAATGACCCGGGGG + Intergenic
1129793760 15:78360730-78360752 AGCCTTGGATGGTGGCCCTGCGG + Intergenic
1132483508 16:178059-178081 AGCATTCTGGGGTGACCTGGGGG - Intergenic
1132609288 16:807341-807363 AGCTTTCGAGGGTCACACCGCGG - Intronic
1132665674 16:1080381-1080403 AGCCTTGGACGGGGACCCGGTGG - Intergenic
1133716752 16:8457619-8457641 AGAATTCAAGGGTGAGCCGGTGG - Intergenic
1138561189 16:57801993-57802015 AGCCTTCCAGGGAGCCCTGGGGG + Intronic
1140300605 16:73753649-73753671 AGCATTTGAGGGTGAGCTGGTGG - Intergenic
1143639847 17:8189743-8189765 TGCCGTCGAGGGGGACCAGGCGG - Exonic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1145747776 17:27332855-27332877 AGGCGTCCAGGGTGACTCGGAGG + Intergenic
1150727479 17:67663245-67663267 AGAATTCAAGGGTGAGCCGGTGG + Intronic
1151620752 17:75243402-75243424 AGCCTTCGAGGGCTGCCTGGAGG + Intronic
1159065768 18:63566690-63566712 TGTCTTCCAGGGTGAACCGGGGG - Exonic
1160510276 18:79449691-79449713 GTCCTGCGAGGGTGACCCGCAGG + Intronic
1160754712 19:751315-751337 AGGCTCCGAGGGTGACGGGGTGG - Intronic
1161742907 19:6035164-6035186 AGCCTCTGAGGGTCACACGGTGG - Intronic
1161922201 19:7274940-7274962 AGAATTCGAGGGTGAGCTGGTGG + Intronic
1164560989 19:29292100-29292122 AGCATTCAAGGGTGAGCTGGTGG + Intergenic
1165200742 19:34142355-34142377 AGAATTCAAGGGTGAGCCGGTGG + Intergenic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
926144658 2:10389392-10389414 AGAATTCAAGGGTGAGCCGGTGG - Intronic
927231122 2:20825188-20825210 AGAATTCAAGGGTGAGCCGGTGG - Intergenic
933651947 2:84856696-84856718 AGACTTCGGGGGTGTCCAGGAGG - Intronic
934719948 2:96566982-96567004 AGAATTCAAGGGTGAGCCGGTGG - Intergenic
935348046 2:102126975-102126997 AGCCTTCTAGGCTGACAAGGGGG - Intronic
944440963 2:199743008-199743030 AGCCTTCAGGGGTTACCTGGAGG + Intergenic
946805861 2:223470842-223470864 AGAATTCAAGGGTGAGCCGGTGG + Intergenic
948382414 2:237559935-237559957 AGCCCTAGAGGGTGGCCAGGTGG - Intergenic
948642647 2:239385363-239385385 AGTCCTCGGAGGTGACCCGGAGG - Intronic
948721581 2:239904179-239904201 AACCTTCCAGTGTGCCCCGGGGG + Intronic
1168777752 20:462284-462306 GGCCTGCGAGGGCGGCCCGGGGG - Intronic
1174351433 20:49971042-49971064 AGCCTTCGAGGGTGGACATGTGG - Intergenic
1179277703 21:39907323-39907345 AGCTTTCTTGGGTGACCCTGGGG - Intronic
1179411614 21:41167632-41167654 AGCTTCCGGGGGTGACTCGGAGG - Intergenic
1184138938 22:42566352-42566374 AACCTTGGCGGGGGACCCGGAGG - Intronic
1184612721 22:45615265-45615287 AGAGTTCGAGGGTGAGCCGGTGG + Intergenic
950304576 3:11908117-11908139 AGCCTCCCAGCGTGACCCTGTGG + Intergenic
953408175 3:42670536-42670558 AGAATTCAAGGGTGAGCCGGAGG + Intergenic
960460249 3:117925412-117925434 AGACTTCTGGGGTGACCCAGAGG - Intergenic
961246970 3:125462845-125462867 AGAATTCAAGGGTGAGCCGGTGG + Intronic
975870869 4:78776687-78776709 ACTCTTCCAGGGTGACCTGGTGG - Exonic
985166639 4:187102265-187102287 ACCCTTGAAGGGTTACCCGGAGG - Intergenic
985532699 5:443280-443302 AGCCGTAGAGGGTGAGTCGGTGG + Exonic
993596192 5:89858924-89858946 AACCTTCGTGGATGACCTGGAGG - Intergenic
993865613 5:93191074-93191096 AGCCTTCCAGGGTCACCTTGTGG + Intergenic
999383211 5:151136315-151136337 AGCCTACGAGCGGGACCTGGAGG - Exonic
1002381117 5:178830967-178830989 AGCCTTGTAGGGTGGGCCGGTGG - Intergenic
1002628716 5:180552737-180552759 AACCTTCAAGGGTGAGCCGGGGG - Intronic
1002715511 5:181224266-181224288 AGACTACGAGGGTGACATGGAGG + Exonic
1007408617 6:41648899-41648921 AGCCTGCAATGGGGACCCGGGGG + Intronic
1007696464 6:43737072-43737094 GGCCTTGTAGGGTGACACGGTGG + Intergenic
1011360219 6:86515966-86515988 AACCTTCAAGGATGACCTGGTGG - Intergenic
1018561264 6:165102884-165102906 AGCCTGCTAGGCTGACCAGGTGG + Intergenic
1019527634 7:1487833-1487855 GGCCTTCGAGGGGCACCTGGCGG - Exonic
1020118269 7:5488383-5488405 GGCCTTCGAGGGTGGGGCGGGGG + Intronic
1022807492 7:33837455-33837477 AGCCTGCGATGGCGACCAGGAGG + Intergenic
1037828598 8:22175057-22175079 GGCATTGGAGGGTGACCTGGTGG + Intronic
1037915706 8:22772022-22772044 AGACTTCAAGGGTGAACCAGTGG - Intronic
1038490945 8:27970685-27970707 AGAATTCCAGGGTGAGCCGGTGG - Intronic
1038632980 8:29263087-29263109 ACTCTTCGGGGTTGACCCGGCGG + Intronic
1041666919 8:60454752-60454774 AGCCTTTCAGGGTCACCAGGAGG - Intergenic
1049108054 8:140625747-140625769 AACATTTGAGGGTGACCCTGTGG - Intronic
1049373794 8:142279732-142279754 ACCCTCCGAGGGAGACCCAGAGG - Intronic
1049540731 8:143207681-143207703 AGCCTTCCAGGGAGACACAGTGG - Intergenic
1049602951 8:143516360-143516382 AGGGTTCGAGGGTGCCCAGGAGG - Intronic
1059419522 9:114182406-114182428 AGCCCTAGAGGGTTCCCCGGAGG + Intronic
1060656338 9:125374986-125375008 CGCCTTCGAGGATGCCCAGGAGG + Intergenic
1061481901 9:130901620-130901642 AGCCTTTGAAGGTGCCCCTGGGG + Intergenic
1062186549 9:135221516-135221538 AGCCTCCAAGGGTGACCATGGGG + Intergenic
1062449558 9:136609799-136609821 GGGCTTGGAGGGTGACCCAGAGG + Intergenic