ID: 1103952266

View in Genome Browser
Species Human (GRCh38)
Location 12:124557776-124557798
Sequence CTGGGTAAACCAGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103952266_1103952274 -5 Left 1103952266 12:124557776-124557798 CCTTCCTCCCCTGGTTTACCCAG 0: 1
1: 0
2: 3
3: 29
4: 306
Right 1103952274 12:124557794-124557816 CCCAGCAGTGGGCATCACCCAGG 0: 1
1: 0
2: 3
3: 31
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103952266 Original CRISPR CTGGGTAAACCAGGGGAGGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900174326 1:1285145-1285167 CTGGGGACACCAGGTGGGGACGG - Intronic
900324928 1:2104057-2104079 CTGGGGAGAGCAGGGGAGGGGGG + Intronic
902783236 1:18717468-18717490 CTGGCTAAGCGAGGAGAGGAGGG - Intronic
903372748 1:22847461-22847483 CTGGACACAACAGGGGAGGAAGG + Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
904983450 1:34525648-34525670 CCAGGTGACCCAGGGGAGGAGGG + Intergenic
905168888 1:36098644-36098666 AGGGGTGAGCCAGGGGAGGATGG - Exonic
905415742 1:37802665-37802687 CTGGGGAAACCAAGGCAGGCAGG + Intergenic
908475964 1:64488968-64488990 CTGGGAACAGCAGGGGATGAGGG + Intronic
909497129 1:76290871-76290893 GTGAATAAAACAGGGGAGGAGGG + Intronic
912546888 1:110457409-110457431 CTGTGGCAACCTGGGGAGGAAGG + Intergenic
914970601 1:152305523-152305545 CGGGGTCAAGCAGAGGAGGAAGG - Exonic
914970756 1:152306495-152306517 CGGGGTCAAGCAGAGGAGGAAGG - Exonic
914970913 1:152307467-152307489 CGGGGTCAAGCAGTGGAGGAAGG - Exonic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
914971395 1:152310386-152310408 CGGGGTCAAGCAGAGGAGGAAGG - Exonic
914971855 1:152313305-152313327 CGGGGTCAAGCAGAGGAGGAAGG - Exonic
915130579 1:153693083-153693105 CTGGGTAGGACAGGGGAGAAGGG - Intronic
916079249 1:161222243-161222265 CTGGGAAAAGTAGGGGAGTAAGG - Intergenic
916896860 1:169172458-169172480 CTTGGTAAGCAAGGGGATGATGG + Intronic
918454123 1:184689440-184689462 CTGGGGACAGCAGAGGAGGAAGG - Intergenic
919805731 1:201380064-201380086 CTGGGCACCCCAGGGGAGGGGGG + Intronic
919808171 1:201393072-201393094 TGGGGAAGACCAGGGGAGGAAGG + Intronic
920154138 1:203934426-203934448 CTGAGGAAACCAGGAGAGGAGGG + Intergenic
920913329 1:210237395-210237417 CTGCGGAAACGAGAGGAGGAGGG + Intronic
923859546 1:237879433-237879455 CTGGCTAACACAGGGGAGGAGGG + Intronic
1063143133 10:3273782-3273804 CAGGGGAAACGAGGAGAGGATGG + Intergenic
1063345539 10:5308864-5308886 CAGGCTAAAGCAGGTGAGGAGGG + Intergenic
1064634381 10:17348846-17348868 CTGAGGAACCCAGGGTAGGAAGG - Intronic
1066365973 10:34777284-34777306 CTGAGTCCACCAGGGGAAGAGGG - Intronic
1066653594 10:37680801-37680823 CTCGGGAAAGCAGGGGAGGCCGG + Intergenic
1068819166 10:61353125-61353147 CTGGATAAAAGTGGGGAGGAAGG - Intergenic
1070116278 10:73531766-73531788 CTGGGAAAACCAGGAGAGCTGGG + Intronic
1070700054 10:78595390-78595412 GGGAGTAAACCAGGGAAGGAGGG - Intergenic
1070774456 10:79101676-79101698 CTGGGTGAACCAGGGCAGGGAGG + Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1072456925 10:95584616-95584638 CTGGTTATCCCAGGGCAGGATGG - Intergenic
1075282456 10:121151655-121151677 CAGAGTAAACAAGGGGAGAATGG - Intergenic
1075731727 10:124640378-124640400 CTGGGATAACAAGGGGAGTAGGG + Intronic
1076096524 10:127737895-127737917 TTGGGGATACCCGGGGAGGAGGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077300563 11:1844633-1844655 CTGGGTCCTTCAGGGGAGGACGG - Intergenic
1077321849 11:1946380-1946402 CAGAGGAAACCAGGGGAGGAGGG + Intergenic
1081735875 11:45403789-45403811 CTGGGTAATCTAGGAGGGGATGG - Intergenic
1082867394 11:57912350-57912372 CTGGGAAGTCCAGGGCAGGAGGG - Intergenic
1083296502 11:61718222-61718244 CTGGCCAGACCAGGGGAGGAGGG - Intronic
1083932187 11:65852162-65852184 TTGGGCAAAGCAGGGGAGGGAGG - Intronic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084682640 11:70675784-70675806 CTGGGTAATGCCAGGGAGGAAGG + Intronic
1084782752 11:71421499-71421521 CTTGGTAGGACAGGGGAGGAAGG + Intergenic
1084943178 11:72625224-72625246 GTTGGTGGACCAGGGGAGGATGG - Intronic
1085817852 11:79760008-79760030 CCAGGGAAACCAGGGCAGGAAGG + Intergenic
1089247624 11:117133818-117133840 CTGGGTAACCCAGGATGGGATGG - Intergenic
1090199906 11:124846475-124846497 CTGGGTCACCCCGGGGAGGCTGG - Intergenic
1202804866 11_KI270721v1_random:1693-1715 CAGAGGAAACCAGGGGAGGAGGG + Intergenic
1091804616 12:3346849-3346871 CTGGGTATACCCTGGAAGGAAGG - Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1093024231 12:14232222-14232244 CTGGCTCAGCCTGGGGAGGAGGG - Intergenic
1093511730 12:19936916-19936938 CAGGACAAACCAGGGAAGGAGGG + Intergenic
1095567586 12:43644481-43644503 CTGGGGAAACCTTGGGAAGAGGG - Intergenic
1097046418 12:56190167-56190189 CTGGGTGACCCAGGGAGGGAGGG - Intergenic
1100150363 12:91729263-91729285 GTGGATAGACCATGGGAGGAAGG + Intergenic
1101519790 12:105470991-105471013 CTGGGGGTAACAGGGGAGGAAGG + Intergenic
1102112339 12:110373925-110373947 CTGGCTGGAGCAGGGGAGGATGG + Exonic
1102547551 12:113667582-113667604 CTGGGGATACCAGGTGGGGAGGG - Intergenic
1102955898 12:117058898-117058920 CTGTGAAAGGCAGGGGAGGAGGG - Intronic
1103598750 12:122040766-122040788 ATGGGTACAGCAGGGGATGAAGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104087811 12:125492509-125492531 CTGGGAACACCAGGGGAGGCCGG - Intronic
1105471767 13:20701551-20701573 CTGAGTAAACCAGGGGATGAGGG + Intergenic
1106076041 13:26462058-26462080 GTGGGTAAACCAGGGCAGATGGG - Intergenic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1111096777 13:83525946-83525968 CTGTTTAAACCATGAGAGGAAGG + Intergenic
1115872714 14:37823235-37823257 CTGTGGACACCAGGAGAGGAGGG - Intronic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1118771108 14:68943352-68943374 CTGGGTAGTGCAGGGCAGGACGG + Intronic
1119712146 14:76829976-76829998 TTGGGCAAACTAGGGGAGGGGGG + Intronic
1120836125 14:89039878-89039900 CAGGATAAGCCAGGGCAGGATGG - Intergenic
1122242174 14:100376241-100376263 CAGGGTAAGCGAGGGGAGTAAGG - Exonic
1122632569 14:103113779-103113801 CTGGGGTCACCAGGCGAGGAAGG - Intergenic
1122686377 14:103509728-103509750 CTGGCTAAGCCAGGAGAGGGAGG - Intergenic
1122697294 14:103562364-103562386 CGGGGGAAGCCGGGGGAGGAGGG + Intronic
1123041686 14:105492851-105492873 TTGGGTAAGCCAGGGCAGGAAGG - Intronic
1128249560 15:66154909-66154931 CTAGAGAAACCAGGGTAGGAAGG - Intronic
1128632837 15:69282845-69282867 CTGGGTGAACCTGGGGTGGGTGG - Intergenic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1129455731 15:75675416-75675438 CTGGAGACACCAGGGGTGGAGGG - Exonic
1129606600 15:77028162-77028184 CTGGGGACTCCAGGGGTGGAGGG + Intronic
1129888145 15:79052896-79052918 CTGGGGAAAGGAGGGGAGGGTGG - Intronic
1130474115 15:84248170-84248192 CTGGGAAAAGCAGAAGAGGAAGG + Intergenic
1130481530 15:84362238-84362260 CTGGGAAAAGCAGAAGAGGAAGG + Intergenic
1130980866 15:88811067-88811089 CTTGGAGAACCAAGGGAGGAAGG - Intronic
1131009362 15:89004392-89004414 TTGTGTAAAACAGGAGAGGATGG - Intergenic
1132027821 15:98417892-98417914 CTGGGTGTCCCTGGGGAGGATGG - Intergenic
1133052577 16:3125582-3125604 CTGGGTAAAACAGGAGAGGACGG + Intergenic
1133252898 16:4495920-4495942 CTGGTTCCAGCAGGGGAGGATGG - Intronic
1134190842 16:12120033-12120055 CTGGGTGGGCTAGGGGAGGAGGG + Intronic
1135420636 16:22303457-22303479 CTGCGTAAGCCTGGGAAGGAGGG - Intronic
1141893479 16:86943555-86943577 CTGGGTAGGCCAGAGTAGGAGGG - Intergenic
1142754382 17:2007274-2007296 GTGGGTGATCCAGAGGAGGAAGG - Intronic
1143231705 17:5361575-5361597 CTGGGTAACGCTGGAGAGGAGGG - Exonic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1145236758 17:21213986-21214008 GCGGGGAAACCAGGGAAGGAAGG + Intronic
1145262956 17:21365567-21365589 CAGGGGAATCCAGGGGTGGATGG - Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1148382994 17:47213566-47213588 TTGGTTGAACCTGGGGAGGAGGG + Intronic
1148836209 17:50467180-50467202 CTGGGCACCCCAGGGGAGAAAGG + Intronic
1149584117 17:57773685-57773707 CTGGGTTGACCAGGAGAGGAAGG + Intergenic
1150715908 17:67572458-67572480 CTGGGTAAAGCGGGGGGGGGGGG + Intronic
1151630841 17:75309731-75309753 CTGGGAAGACCTGGGGTGGAGGG - Intergenic
1151895299 17:76976347-76976369 GGGGGTGAACCAGGGAAGGAAGG + Intergenic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152386296 17:79976893-79976915 CTGCGTGAAGCAGGAGAGGATGG - Intronic
1152470248 17:80487164-80487186 CTGGGCACACCAGGGAAGCAGGG + Intergenic
1152737378 17:82004186-82004208 CTGGGAAACCGAGGGGAGGGAGG - Intronic
1153901304 18:9619373-9619395 CTGGGAAAAGCACGGGAGTAGGG - Intergenic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1157524501 18:48370402-48370424 CAGGGTAAAGCAGGGAATGAGGG + Intronic
1159851029 18:73527463-73527485 GTGTGGGAACCAGGGGAGGAGGG - Intergenic
1160038206 18:75320615-75320637 GTGGGTAACTCAGGGCAGGAAGG - Intergenic
1161012735 19:1968198-1968220 CTGGGGCAGCCTGGGGAGGAGGG - Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161415686 19:4145303-4145325 ATGGGGAAAGAAGGGGAGGAGGG + Intergenic
1162030810 19:7916553-7916575 CCGGGGACACCAGGGGCGGATGG + Intronic
1162198712 19:9006062-9006084 CTGGGTAGACCAGGACATGAGGG - Intergenic
1162523398 19:11194660-11194682 CTGGGTGAACCAGCTGTGGAGGG - Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163489997 19:17611856-17611878 CTGGGCAGGGCAGGGGAGGATGG + Intronic
1164770046 19:30801558-30801580 CTGGCTTAACCAGGGGAGAATGG + Intergenic
1165475361 19:36027100-36027122 CTGGGGAAACCAGGGGGAGAGGG - Intronic
1165839770 19:38781354-38781376 CTCTGTAAACTAGCGGAGGAGGG - Intergenic
1166311891 19:41967557-41967579 GTGGGGACACCAGGGGAGGTGGG + Intronic
1166313668 19:41976705-41976727 CTGGGAGAAGCAGGGGAGAAGGG + Intronic
1167103691 19:47418917-47418939 CTGGGAGACCCAGGGGCGGAGGG + Intronic
1167162627 19:47778250-47778272 CGGGGTAGACCAGGTGAGGGAGG - Intergenic
1167220902 19:48197354-48197376 CTGGGGGAAGCAGGAGAGGAAGG + Exonic
1167284558 19:48591743-48591765 CAGGGTAAAGCGGGGCAGGAGGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167674572 19:50876459-50876481 CTGGCTATTCCTGGGGAGGAAGG - Exonic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1168410095 19:56134403-56134425 CTGGGTACAGCAGGCAAGGAGGG + Intronic
925422869 2:3726113-3726135 CAGGGGAAACCAGGGGTGGGAGG + Intronic
925493801 2:4423917-4423939 TTGGGTAAAGCGGGGGAGGATGG + Intergenic
926312764 2:11686409-11686431 CAGGGTGAAACAGGAGAGGAGGG + Intronic
927439930 2:23107061-23107083 CTTGGTAAGGCAGGTGAGGAAGG + Intergenic
928961916 2:36935051-36935073 CTGGGCAACAGAGGGGAGGATGG + Intronic
930270002 2:49245053-49245075 CTGGGTAAATAACGAGAGGAAGG + Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
932457612 2:71859314-71859336 CTCAGTAAACCAGGGAGGGATGG + Intergenic
933996599 2:87674600-87674622 CTGGGTGAACCCCAGGAGGAGGG - Intergenic
936297253 2:111276310-111276332 CTGGGTGAACCCCAGGAGGAGGG + Intergenic
937589272 2:123593889-123593911 CTGGGTCACCTAGGAGAGGAAGG + Intergenic
937906559 2:127055474-127055496 CTGGGGAACCCAGGGCAGGGAGG + Intronic
937989358 2:127653780-127653802 CTGGGAGAAGCCGGGGAGGAAGG + Intronic
938152050 2:128895432-128895454 CTGGGGGCTCCAGGGGAGGAGGG + Intergenic
939010134 2:136836894-136836916 CTGGGTAAAGATGGGGAAGATGG - Intronic
939979967 2:148768057-148768079 CAGGGTCATCCAGGGGAGAAAGG - Intronic
940708769 2:157136433-157136455 CTAGGTAAACTAGGGTAGGATGG - Intergenic
940886534 2:158994511-158994533 TTGGGGAAGCCAAGGGAGGAAGG - Intronic
942734077 2:179090643-179090665 CTGGGTAAACAAGGAAATGAAGG - Intergenic
946225393 2:218261632-218261654 CTGGGGGAACCTGGGAAGGAAGG + Intronic
946484966 2:220092690-220092712 CTGTGCAAACCAGGAGGGGAGGG + Intergenic
947635789 2:231680305-231680327 CTGGGGACACCTGGGGAGGCGGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948653445 2:239463050-239463072 CTGGGTCAGCCAGGGGAGGGTGG + Intergenic
1168813260 20:720025-720047 CTGGGTGCCCCTGGGGAGGAAGG + Intergenic
1169273604 20:4218558-4218580 CTGGGTTAACCGGGGCAGGGAGG + Intergenic
1169850914 20:10049714-10049736 ATGAGAAAACCCGGGGAGGAGGG + Exonic
1169980426 20:11378521-11378543 CTGGCTAAAACAGGTGAGGGGGG - Intergenic
1170562373 20:17569280-17569302 CTGGGCCAATCAGGGGAGGGCGG + Intergenic
1171052674 20:21874470-21874492 CTGGGTCAGGCAGGAGAGGAGGG + Intergenic
1171370482 20:24659036-24659058 CTGGGTAACCCAGGAAAGGAGGG - Intronic
1172515131 20:35528135-35528157 CTGGTTGCACCTGGGGAGGAAGG + Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173095203 20:40020494-40020516 CTGGGAAAACCATAAGAGGAGGG + Intergenic
1173154984 20:40601101-40601123 CAGGTTAAGGCAGGGGAGGAGGG + Intergenic
1173522542 20:43710504-43710526 CTGGGAAGAGCAGGGGAGAAGGG - Intronic
1174832580 20:53826429-53826451 CTGGGCAAGACAGGGCAGGATGG + Intergenic
1175997818 20:62819246-62819268 CCGGGGAAACCAGGAGAGGCTGG + Exonic
1178440850 21:32597121-32597143 CTGGGGACAGCAGGGAAGGATGG - Intronic
1179114773 21:38480150-38480172 CTGGGTGGAGCAGGGCAGGATGG + Intronic
1179575379 21:42305244-42305266 ATGGAGAAACCAGGGCAGGAAGG - Intergenic
1179580129 21:42338338-42338360 CCAGGGAAACCAGGGGAGGGAGG - Intergenic
1179680841 21:43020313-43020335 CTGCGCAGACCAGGGAAGGAAGG - Intronic
1180618038 22:17141324-17141346 CTGGGTGCACCATGGGTGGAGGG - Intronic
1181376855 22:22465589-22465611 CTCAGTAAGCCAGGGGAGCAAGG - Intergenic
1181436515 22:22914323-22914345 TTGGGGAGACCAGGGAAGGAGGG - Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181536582 22:23549413-23549435 AGGGGAAAACCAGGGGAGGGTGG - Intergenic
1181914435 22:26268356-26268378 TTAGGTAAAGCAGGGGTGGAGGG - Intronic
1182441684 22:30368316-30368338 CTGGGTAAACCAGGCCATGATGG - Intronic
1182519783 22:30878809-30878831 ATGGGAAAACCTGGGGAGGAAGG + Intronic
1182875264 22:33686269-33686291 TTGGGTACACCAGGGAAAGAGGG - Intronic
1183301346 22:37060616-37060638 CTGGGGAAAGCAGCTGAGGATGG - Intronic
1183642494 22:39101048-39101070 CTGTATAAACCAGGGAAGGCAGG + Intronic
1183775685 22:39963313-39963335 CTGGGTCTACAAGGAGAGGATGG - Intronic
1184256990 22:43292966-43292988 CTGGGGAAGCCTGGGGAGGAGGG + Intronic
949599458 3:5582252-5582274 CTGTGTATACCAAGGGAGAATGG - Intergenic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
953551625 3:43907920-43907942 ACTGGGAAACCAGGGGAGGAGGG - Intergenic
953664731 3:44917681-44917703 CTGGGGACATCAGAGGAGGATGG - Intronic
954134976 3:48578346-48578368 CAGGGAAAGCCAGGCGAGGATGG - Exonic
954855913 3:53643324-53643346 GTGGGTAAACCACAGGAGGCTGG - Intronic
956320792 3:67993895-67993917 CTGGTTAATCAAGGGGAGGGGGG + Intergenic
956699763 3:71948518-71948540 CTGAACAAATCAGGGGAGGATGG + Intergenic
959605432 3:108236726-108236748 CTGAGCAGACCAGGGGCGGAAGG - Intergenic
961205490 3:125078077-125078099 AGGGGTAAAGCAGGGGAGGAGGG - Intergenic
961326752 3:126113474-126113496 GTGGGAGACCCAGGGGAGGACGG + Intronic
962192477 3:133326257-133326279 CTCTATAAACCAGGGCAGGAAGG - Intronic
963034129 3:141010419-141010441 CTGTGTGAAACAGTGGAGGAAGG + Intergenic
964529456 3:157651537-157651559 CATGGCAAAGCAGGGGAGGAAGG + Intronic
965769815 3:172169989-172170011 CTGTGTAAAACAGCAGAGGACGG - Intronic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
969399385 4:6943765-6943787 CTCGGAAAACCACAGGAGGACGG - Intronic
969450989 4:7273306-7273328 CTGGGCACACCAGGGAAAGAGGG - Intronic
970513851 4:16807683-16807705 AAGGGTACACCAGGGCAGGAAGG - Intronic
974307544 4:60160170-60160192 CTGGGTAAACAAGGAAACGAAGG + Intergenic
975039572 4:69728623-69728645 CTGGATACATCAGGGAAGGAAGG + Intronic
977652316 4:99484902-99484924 GGTGATAAACCAGGGGAGGAGGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
979415298 4:120430535-120430557 CTGAGTAAACCATAGGAGTAAGG - Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
980925793 4:139136107-139136129 CTGGGTAATCTAGGAGGGGATGG + Intronic
981962276 4:150555114-150555136 CTCTTTAAACAAGGGGAGGAAGG + Intronic
983568603 4:169180550-169180572 CAGAGTAAACAAGGGGAGTATGG + Intronic
984824701 4:183914116-183914138 CTGAGTAGGCCAAGGGAGGAGGG + Intronic
985555038 5:554475-554497 CGGGATAAACCAGGGGTGGGGGG + Intergenic
985555085 5:554604-554626 CGGGATAAACCAGGGGTGGGGGG + Intergenic
985559263 5:574250-574272 CTGGGTAGACCCCGGGAGGTGGG - Intergenic
985757093 5:1725584-1725606 CGGGGTATACCAGGAGAGGAGGG - Intergenic
986253655 5:6083608-6083630 CTGAGTGAGCCAGGGGATGAAGG - Intergenic
987140971 5:14945888-14945910 GTGGGTAAAGCATGGGAGGTGGG - Intergenic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
988962140 5:36380875-36380897 CTGGGTGATCCTGGGAAGGATGG + Intergenic
989166873 5:38440965-38440987 CTTGGTAACCCAGGAGAGCAGGG + Intronic
990751297 5:59019616-59019638 CTGGATAAGGCAGGGTAGGATGG - Intronic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994150828 5:96445799-96445821 CTGGGTAAACCCGGGGGTAATGG + Intergenic
994276885 5:97849446-97849468 CTGGGAAAAACAAGGCAGGAAGG - Intergenic
995156180 5:108915938-108915960 CTGTGTCAAGCAGGGGAGTATGG - Intronic
995428492 5:112049569-112049591 CTGAGTAGACCAGGGGCAGAAGG + Intergenic
997145011 5:131423064-131423086 CTGGGAAAACCTGGTGAAGAGGG + Intergenic
998102923 5:139449193-139449215 CTGGGTTAAAGAGAGGAGGAGGG + Intronic
1000133595 5:158322956-158322978 TTGGCTAAACCATCGGAGGATGG + Intergenic
1000448372 5:161353386-161353408 CTTGGTAAACCAGTTGAGAATGG + Intronic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001335200 5:170790986-170791008 CTGGGAAAACCAGGGGATATTGG - Intronic
1001902869 5:175445469-175445491 CTGGGGCAACCAGGGGAGGCTGG - Intergenic
1002103240 5:176867703-176867725 GTGGGTAAAAGAGGTGAGGAAGG - Intronic
1002212920 5:177609110-177609132 CTGGGCCAAGCAGGGGAGGATGG - Intronic
1002644887 5:180648257-180648279 CTGGCTCAACCAGGGGAGGAGGG - Intronic
1002706126 5:181161666-181161688 CTGGGGAAACCAGGAGTTGAAGG - Intergenic
1003459817 6:6319603-6319625 CTGGGTAATCCAGGGGATCAAGG - Intronic
1004418576 6:15447459-15447481 CTGTGTTACCCAGGGCAGGAAGG + Intronic
1004496994 6:16173970-16173992 CAGGGTAACCCAGGGAAGAAGGG - Intergenic
1004716308 6:18219613-18219635 CTGAGGAAACCAGGGAGGGAGGG - Intronic
1005476119 6:26209876-26209898 CTGGGAGAACCAGGTGATGATGG - Intergenic
1005684945 6:28245331-28245353 CTGGGAAAGTCAGGGTAGGACGG - Exonic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1006386836 6:33735654-33735676 CTCTGGAAAGCAGGGGAGGAAGG + Exonic
1007345708 6:41228236-41228258 CTCTGCAGACCAGGGGAGGAGGG - Intergenic
1008634049 6:53391732-53391754 CTGAGGAAACCAGGGGACAAGGG + Intergenic
1010769469 6:79812101-79812123 TTAGGTAAACCCAGGGAGGAGGG - Intergenic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1013237340 6:108208845-108208867 CAAGGTTAACCAGGAGAGGATGG - Intergenic
1014818463 6:125959649-125959671 TTTGGCAATCCAGGGGAGGAGGG + Intronic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1019097587 6:169597541-169597563 CTGGATAAACCAGGAGTTGATGG - Intronic
1019155235 6:170034120-170034142 CTAGGTAGACTAGAGGAGGAGGG - Intergenic
1020028520 7:4916681-4916703 CTGATTAAAGTAGGGGAGGATGG - Intronic
1020466122 7:8481829-8481851 CTGGGGACTACAGGGGAGGAAGG - Intronic
1022340299 7:29461314-29461336 GTGGGAGACCCAGGGGAGGATGG + Intronic
1023036462 7:36135674-36135696 CTGGGCAAGCCAGGGAAGAAAGG - Intergenic
1023518670 7:41029089-41029111 CTGAGGACATCAGGGGAGGAGGG - Intergenic
1024708619 7:51989498-51989520 CTGGGAATACAAGGGGTGGAGGG - Intergenic
1026149099 7:67772961-67772983 CTGGGAAACCCAGGAGAGGATGG - Intergenic
1027199875 7:76057202-76057224 CTGGGGAAAGCAGGGTAGAAGGG + Intronic
1027504815 7:79003071-79003093 CTGAGCTAAGCAGGGGAGGAAGG - Intronic
1029380903 7:100213927-100213949 GAGGGTAACCCAGGGGAGGATGG + Intronic
1029547088 7:101216327-101216349 CTGGGTGAGGAAGGGGAGGATGG + Intronic
1029582043 7:101443184-101443206 CTGGGCAATCCAGTGCAGGATGG - Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1030309277 7:108053355-108053377 CTGGGTAAACTACAGGTGGAAGG - Intronic
1031627216 7:124004961-124004983 CTGAGTTAACCTGGGGTGGAAGG - Intergenic
1033915112 7:146314748-146314770 CTGGGTCAAGCTGGGGAAGAAGG + Intronic
1034111811 7:148544481-148544503 CTGGAGAAATAAGGGGAGGAAGG + Intergenic
1034407651 7:150915972-150915994 CTGGGTCAATCAGGGAGGGAAGG + Intergenic
1034533402 7:151711964-151711986 CTGGGAAACCCAGAGGAGGGCGG - Intronic
1036679718 8:10862908-10862930 CTGGGTAATGCAGGGGTGGGGGG + Intergenic
1036694317 8:10964734-10964756 CTGGGGAAATCAAGGGATGAGGG - Intronic
1036971319 8:13358386-13358408 CTGGGTAGAAGAGTGGAGGATGG + Intronic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1038018247 8:23532560-23532582 CTGGGGAAAGCAGGGGCAGAAGG + Intronic
1038155840 8:24989521-24989543 CTCAGTAAAGCTGGGGAGGAGGG - Intergenic
1038714500 8:29979833-29979855 CTGGGGAAATCTGGGGAAGAAGG - Intergenic
1038947530 8:32377704-32377726 CTGGGTGAAATTGGGGAGGAGGG - Intronic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1039465787 8:37784252-37784274 CCGGGGAAACCAGTAGAGGAAGG - Intronic
1041285123 8:56252758-56252780 GTTGGGAAACGAGGGGAGGAAGG + Intergenic
1044667778 8:94648683-94648705 CCTGGTAAACCAGTGGGGGAGGG + Intronic
1047742106 8:127814847-127814869 CTGTGGATACCAGGGGATGAGGG - Intergenic
1049103169 8:140593947-140593969 CTGAGTGAACCTGGTGAGGATGG - Intronic
1049224217 8:141441927-141441949 CCGCGTAAAACAGGGCAGGAGGG - Intergenic
1049431907 8:142569233-142569255 CTGGGTCGACCAGGTGAGAATGG - Intergenic
1049614992 8:143572177-143572199 CTGGGGAACCTAGGGCAGGATGG + Exonic
1051681381 9:19611327-19611349 GGGGGCAAAGCAGGGGAGGAAGG + Intronic
1051797218 9:20885749-20885771 ATGGCAAAACCAGGGGAAGAGGG + Intronic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1056514101 9:87333706-87333728 CTGGGTGAAGGAGGGGAGCATGG - Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1059269230 9:113061584-113061606 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059270366 9:113067033-113067055 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059271502 9:113072483-113072505 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059272633 9:113077927-113077949 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059273768 9:113083369-113083391 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1059274902 9:113088815-113088837 CTGTGGAAAGCAGGGGAAGATGG - Intergenic
1060932219 9:127496293-127496315 CTGGGAAATCCTGGGGAGGTGGG + Intronic
1060961079 9:127681197-127681219 GTGGGGAAAGCAGGAGAGGAGGG - Intronic
1061495511 9:130971600-130971622 GTCAGTGAACCAGGGGAGGAGGG - Intergenic
1061954887 9:133956264-133956286 CTGGGTAGACGAGGGGATCATGG - Intronic
1185660854 X:1727792-1727814 CTGGGGCAGCCTGGGGAGGAGGG + Intergenic
1186107923 X:6226746-6226768 CTTGGAAAACCAGAGGCGGAGGG + Intronic
1186455476 X:9707125-9707147 CTTGTTAAAGCAGGAGAGGATGG + Intronic
1188473657 X:30567650-30567672 TTGGTGAAGCCAGGGGAGGAAGG + Intronic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1194898933 X:99482843-99482865 CTGGTAATACCAAGGGAGGATGG - Intergenic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic
1197762238 X:130036119-130036141 CTGGGTGAATGAGGTGAGGAGGG - Intronic
1198517097 X:137420615-137420637 CTTAGTAAACCAGGTGAGGGAGG - Intergenic
1198809708 X:140523103-140523125 CTGGAGAAACCAGCAGAGGATGG + Intergenic
1200043525 X:153387574-153387596 CCGGGTAGGCCAGGGCAGGAGGG + Intergenic
1202587187 Y:26443860-26443882 CTGGGCAACAGAGGGGAGGAGGG - Intergenic