ID: 1103954383

View in Genome Browser
Species Human (GRCh38)
Location 12:124568031-124568053
Sequence CGCAGGGAGGGCCCTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103954377_1103954383 -2 Left 1103954377 12:124568010-124568032 CCGCTGGATGGGGAGGGGGCGCG 0: 1
1: 0
2: 4
3: 23
4: 230
Right 1103954383 12:124568031-124568053 CGCAGGGAGGGCCCTACACAGGG 0: 1
1: 0
2: 1
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103954383 Original CRISPR CGCAGGGAGGGCCCTACACA GGG Intergenic
902777583 1:18684554-18684576 AGCAGGGAGGGCCCTTGCCATGG + Intronic
902892472 1:19454212-19454234 TGCAGGGATGGCGCTACTCATGG - Intronic
903438158 1:23368149-23368171 GGCAGGGAGGGCCCTGGACCAGG + Intronic
905771968 1:40644183-40644205 CGCAGGGCGGGCCCTAGGTATGG - Intronic
915447720 1:155983579-155983601 AGCAGAGAGGGTCGTACACAGGG - Intronic
915849263 1:159303726-159303748 CCCAGGGAACGCCCAACACAGGG - Intronic
915933849 1:160078464-160078486 CACTGGCAGGGCCCTCCACAAGG - Intergenic
916483375 1:165235571-165235593 CGCAGGGTGGGCCCTAATCCCGG + Intronic
920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG + Intronic
922701823 1:227765775-227765797 CACAGGGATGGCCCTAAAGAGGG - Intronic
923507366 1:234616469-234616491 CACAGAGAGCTCCCTACACAAGG + Intergenic
924582707 1:245335750-245335772 CGCAGGGAGAGTCCCACGCAGGG + Intronic
924582779 1:245336012-245336034 CGCAGGGAGAGTCCCACGCAGGG + Intronic
1062998762 10:1893938-1893960 CTTAGGGAGGGCACTAAACACGG - Intergenic
1067041056 10:42953475-42953497 AGCATGGAGGGCCCTTCCCAGGG - Intergenic
1071112205 10:82172816-82172838 GACAGGGAGGGCCCATCACAAGG - Intronic
1072613003 10:97031502-97031524 CACAGCGTGGGCCCTAGACATGG + Intronic
1074949129 10:118311915-118311937 CACATAGAGGGCCCTGCACAGGG - Intronic
1077230705 11:1457117-1457139 GGCATGGAGGGCCCTGCTCAGGG - Intronic
1077333808 11:1994598-1994620 CGGAGGGACGGCCCCGCACAAGG - Intergenic
1080321141 11:31010614-31010636 TGAAGGGAGGGCATTACACAGGG + Intronic
1081708613 11:45202184-45202206 CGCAGGGAGGGCATGGCACATGG - Intronic
1083925633 11:65804328-65804350 CCCACAGAGGTCCCTACACAAGG - Intergenic
1084435813 11:69138765-69138787 GTGAGGGAGGGCACTACACAAGG + Intergenic
1084556724 11:69880105-69880127 GGCAGGGATGGCCCTGCCCAGGG + Intergenic
1090387787 11:126366577-126366599 AGAGGGGAGGGCCCTGCACACGG - Intronic
1091054509 11:132405801-132405823 GGGAGGGAGGGCCCAACACCGGG - Intergenic
1202816791 11_KI270721v1_random:49780-49802 CGGAGGGACGGCCCCGCACAAGG - Intergenic
1091826414 12:3516082-3516104 GGCAGGGTGGGCCATTCACATGG + Intronic
1092617390 12:10227680-10227702 ATGAGGCAGGGCCCTACACAGGG - Intergenic
1092966253 12:13646470-13646492 CACAGGGAGGGGATTACACAGGG - Intronic
1100711118 12:97258031-97258053 CACAGGGAGGAATCTACACAAGG + Intergenic
1101441040 12:104704425-104704447 GGCGGGGAGAGCCCAACACAAGG - Intronic
1103954383 12:124568031-124568053 CGCAGGGAGGGCCCTACACAGGG + Intergenic
1105882705 13:24617848-24617870 GGTAGGGAGGGCCCCAAACACGG - Intergenic
1113641704 13:111962379-111962401 TGCAGAGTGGGCTCTACACACGG + Intergenic
1114474894 14:22987400-22987422 CTGAGGGAGGCCCATACACACGG + Exonic
1117885879 14:60362351-60362373 CACAGGGAGGGGATTACACAGGG + Intergenic
1122552401 14:102557065-102557087 CGCAGGGAGGGCACTACACCTGG - Intergenic
1123769213 15:23511862-23511884 AGCAGGCAGGGTCCTGCACAGGG - Intergenic
1124378193 15:29141835-29141857 CGCAGGGCGGGCTCTCCCCAGGG - Intronic
1124434489 15:29635640-29635662 CACAGGGAGAGGCCTACACGGGG - Intergenic
1125895897 15:43301667-43301689 GCCAGGGAGGGCACTAAACATGG - Intronic
1130062368 15:80579068-80579090 CCCAGGGAGGGCTGTGCACAAGG + Intronic
1132155503 15:99492883-99492905 CGCAGGAAGGGCACTGCACCGGG - Intergenic
1132545886 16:533280-533302 TCCATGGTGGGCCCTACACAGGG + Intronic
1135073342 16:19371487-19371509 CACAGGGAGGGCTGGACACAGGG + Intergenic
1136186191 16:28590304-28590326 GGCAGGGATGGCCCCACAGAGGG - Exonic
1136318008 16:29465511-29465533 GGCAGGGATGGCCCCACAGAGGG + Exonic
1136432583 16:30204860-30204882 GGCAGGGATGGCCCCACAGAGGG + Exonic
1138077418 16:54056459-54056481 GACAGGGAGGGCATTACACAAGG - Intronic
1141961726 16:87413443-87413465 CGCTGGGGGTGCCCTTCACAGGG - Intronic
1142173380 16:88634281-88634303 GGCAGGGAGGGCACTGGACAGGG - Intergenic
1142405130 16:89884290-89884312 GGCAGGGAGTGGCCGACACAGGG + Intronic
1142995829 17:3759767-3759789 AGTATGGAGGGCACTACACAGGG - Intronic
1144542262 17:16155832-16155854 GGCAGGGAGGGCCTTTCAAAAGG + Intronic
1144836881 17:18161185-18161207 CGCAGGGAGGGGCATCCTCAGGG + Intronic
1147338742 17:39741569-39741591 CGCAGTGAGTGCCCCACACGTGG + Intronic
1148798910 17:50210915-50210937 TGCGGGGAGGGCCCTTCAGAAGG - Intergenic
1150865906 17:68849751-68849773 AGAAGGGAGGGGTCTACACATGG + Intergenic
1152340331 17:79720847-79720869 CGCAGGGCAGGCCCTGCCCAAGG + Intergenic
1152769245 17:82157335-82157357 CGCAGGGAGGGCCCAACGCTAGG + Intronic
1154281530 18:13007454-13007476 CTCAGGGAGGGCTTTAAACATGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160290502 18:77589265-77589287 CTCAGGGCGGGCACCACACAGGG - Intergenic
1161044821 19:2129192-2129214 CGCAGGGAATGCCCCACGCAGGG + Intronic
1161044840 19:2129242-2129264 CGCAGGGAATGCCCCACACAGGG + Intronic
1161328137 19:3673110-3673132 GGCAGGGAGGGGGCCACACAGGG - Intronic
1162829789 19:13277261-13277283 CGCAGGGCGTGCACTGCACAAGG + Intronic
1164604919 19:29590871-29590893 CCCAGGATGGCCCCTACACAGGG - Intergenic
1166313826 19:41977786-41977808 CGGAGGGAGGGCCAGACCCAGGG + Intronic
928133893 2:28673628-28673650 CAAGGGGAGGGCCTTACACAAGG + Intergenic
935736187 2:106108381-106108403 TGCTGGGAGGGCTGTACACAGGG - Intronic
936013607 2:108941791-108941813 CGTAGTGAGGGCCTCACACATGG - Intronic
940279904 2:151978395-151978417 CACAGGGAGGACCATTCACATGG - Intronic
941568041 2:167132804-167132826 CCCTGGGAGAGCCCTATACAGGG + Intronic
948596568 2:239083176-239083198 CGCAGGGAGCACGCCACACAGGG + Intronic
1169443620 20:5653435-5653457 CTCAGGGAGGGACATAGACAAGG - Intergenic
1170152425 20:13239408-13239430 CTCAGGGAGGACCCTGCAGATGG - Intronic
1170480839 20:16763564-16763586 CCCAGGGAGGGGCATCCACAAGG + Intronic
1172302966 20:33862894-33862916 CGCAGGGAGGGGCCTAGAGGAGG + Intergenic
1174192106 20:48747928-48747950 CCCATGGACGGCCCTACAGAAGG + Intronic
1174794684 20:53512157-53512179 TGCAGTGAGGGCCCTCCAGAGGG - Intergenic
1178617026 21:34143517-34143539 CCCAGGGGGTGCCCTGCACAAGG + Intergenic
1181407169 22:22693254-22693276 CTCAGGGAGGACACTGCACATGG - Intergenic
1181514089 22:23401706-23401728 CTCAGGGGGGGCCCTTCACGGGG + Intergenic
1182137428 22:27919053-27919075 CGCAGGGAGGGGCTGACACAGGG + Intronic
1182427535 22:30282847-30282869 CCCAGGGAGGGGCCTGCCCACGG - Intergenic
1182760446 22:32718236-32718258 AGCAGGGAGGGCCCTAGAAGGGG - Intronic
1183027131 22:35073695-35073717 CGAAGGGAGGGCATTCCACATGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184163331 22:42712445-42712467 CGCAGGGAAAGCTCTTCACAGGG + Intronic
1184499483 22:44863199-44863221 CAGAGGGAGGGCCCTGCAAAGGG + Intergenic
961460799 3:127049283-127049305 CGCAGGCAGGGCAGTACCCAGGG + Intergenic
966883838 3:184363672-184363694 CTGAGGGAGGTCCCTACACCAGG - Intronic
968549185 4:1213686-1213708 CCCAGGCAGGGCCCCCCACAGGG - Intronic
968923518 4:3534922-3534944 CGGAGGGAGGGCCCTCCACTTGG + Intergenic
968972313 4:3802429-3802451 GGCAGGGAGGGGCCTTCACCTGG - Intergenic
969215308 4:5717350-5717372 AGCAGGGAACGCACTACACAGGG - Intronic
973311954 4:48719316-48719338 CGAAGGGAGGGCATTCCACATGG - Intronic
976221935 4:82762976-82762998 GGCATGGAGAGCCCTACAGAGGG - Intronic
985826417 5:2195043-2195065 GACAGGGATGGTCCTACACATGG - Intergenic
986349871 5:6867400-6867422 CACAGGGAGGGGCTTACACCAGG + Intergenic
988580096 5:32461234-32461256 GCCAGGGAAGGCCCTACAAAAGG + Intergenic
990510013 5:56481269-56481291 CGTAGGGAGGGTCCTCCTCAGGG - Intronic
999331489 5:150676613-150676635 GGCAGGGAGGGGCCCATACATGG + Intronic
1006052172 6:31353633-31353655 CCCAGGGCGGCCCCTGCACACGG - Intronic
1012450445 6:99349078-99349100 CGGAGAGAGGGCCCCGCACAGGG - Intronic
1014395537 6:120923663-120923685 CAAAGGGAGGGGACTACACAGGG + Intergenic
1018746974 6:166769834-166769856 CCCAGGGAGGGCACTGCACAAGG - Intronic
1019162363 6:170077047-170077069 CAAAGGGAGGACCCTGCACAAGG + Intergenic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1020081937 7:5290936-5290958 GGCGGGGAGGGTCCTACACGGGG + Intronic
1023032409 7:36101971-36101993 CTCAAGGAGGGGCCTACACAAGG + Intergenic
1023612305 7:41983326-41983348 CGAAGGGAGGGCCATACATTAGG + Intronic
1029044488 7:97613590-97613612 CTTAGGGAGGGCACTAAACACGG + Intergenic
1034660037 7:152760500-152760522 CGCAGGGAGGGCAGTAAAAATGG - Intronic
1037837376 8:22222053-22222075 AGCAGGGAGGGCCCTGGAGAGGG + Intronic
1038047209 8:23775641-23775663 CCCAGGGAGGGCATTACAAATGG + Intergenic
1040603228 8:48904651-48904673 AGCCTGAAGGGCCCTACACAAGG + Intergenic
1041375616 8:57207515-57207537 CTCAGGGTGGGCCATCCACATGG + Intergenic
1041376379 8:57211894-57211916 CTCAGGGTGGGCCATCCACATGG + Intergenic
1041377321 8:57217288-57217310 CACAGGGCGGGCCATCCACATGG + Intergenic
1042911784 8:73835354-73835376 CTGAGGGAGGGAACTACACAAGG - Intronic
1047972498 8:130097373-130097395 TGCAGGGAGGGCCGTTAACAAGG - Intronic
1049314092 8:141950526-141950548 TGCAGGGAGAGCCCTACCCCAGG + Intergenic
1049476186 8:142797955-142797977 CGCAGGCAGGGGCCTCCCCAGGG - Intergenic
1049548050 8:143243758-143243780 CGCAGGCAGGGCACAAAACAGGG + Intergenic
1049597571 8:143491783-143491805 TGCAGGGTGGGCCCTAGAGAAGG + Intronic
1053284650 9:36842351-36842373 CACAGGGTCTGCCCTACACACGG + Intronic
1053799229 9:41753946-41753968 CGGAGGGAGGGCCCTCCACTTGG + Intergenic
1054145983 9:61561053-61561075 CGGAGGGAGGGCCCTCCACTTGG - Intergenic
1054187640 9:61966005-61966027 CGGAGGGAGGGCCCTCCACTTGG + Intergenic
1054465721 9:65492131-65492153 CGGAGGGAGGACCCTCCACTTGG - Intergenic
1054650877 9:67622576-67622598 CGGAGGGAGGGCCCTCCACTTGG - Intergenic
1059107132 9:111521573-111521595 CGCAGGGAGGGGCTTGCCCAAGG - Intergenic
1059391919 9:114004610-114004632 CGCAGGGAGGAAACTCCACAGGG - Intronic
1062716925 9:138015345-138015367 CTCAAGGAGGGCCCTGCACCTGG + Intronic
1185504336 X:620183-620205 CCCAGGGCTGGCCCTACCCAAGG + Intergenic
1185847260 X:3449401-3449423 AGCCGAGAGGGCCCTACCCAAGG - Intergenic
1185935713 X:4255344-4255366 TGCAGGGAGGGACATACGCAAGG + Intergenic
1186284889 X:8032817-8032839 CGCAGGGAGAGCCTGAAACAGGG - Intergenic
1186310811 X:8316752-8316774 CGCTATGAGGGCCCTCCACATGG - Intergenic
1190840795 X:54142440-54142462 GGCTCGGAGGGTCCTACACACGG + Intronic
1193108330 X:77703536-77703558 CGCAGGCAGGGCCCCAAAGAGGG + Intronic
1200178612 X:154136681-154136703 AGCAGGGAGGGGACTACAAAGGG + Intergenic
1200931408 Y:8700266-8700288 CACAGGGAGAGTCCAACACAAGG - Intergenic