ID: 1103955488

View in Genome Browser
Species Human (GRCh38)
Location 12:124574168-124574190
Sequence GCACAGGAGGGCCCCATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103955476_1103955488 26 Left 1103955476 12:124574119-124574141 CCACCAGGGCATCTGCTTGAGTC No data
Right 1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG No data
1103955477_1103955488 23 Left 1103955477 12:124574122-124574144 CCAGGGCATCTGCTTGAGTCTTT No data
Right 1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG No data
1103955475_1103955488 27 Left 1103955475 12:124574118-124574140 CCCACCAGGGCATCTGCTTGAGT No data
Right 1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103955488 Original CRISPR GCACAGGAGGGCCCCATCAA GGG Intergenic
No off target data available for this crispr