ID: 1103958259

View in Genome Browser
Species Human (GRCh38)
Location 12:124591803-124591825
Sequence GTGAGGGCCCAGAAATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103958259_1103958264 -4 Left 1103958259 12:124591803-124591825 CCCTGACATTTCTGGGCCCTCAC No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103958259 Original CRISPR GTGAGGGCCCAGAAATGTCA GGG (reversed) Intergenic
No off target data available for this crispr