ID: 1103958264

View in Genome Browser
Species Human (GRCh38)
Location 12:124591822-124591844
Sequence TCACTCTCTTCCAGGCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103958260_1103958264 -5 Left 1103958260 12:124591804-124591826 CCTGACATTTCTGGGCCCTCACT No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958254_1103958264 5 Left 1103958254 12:124591794-124591816 CCAGCCCATCCCTGACATTTCTG No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958258_1103958264 0 Left 1103958258 12:124591799-124591821 CCATCCCTGACATTTCTGGGCCC No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958253_1103958264 6 Left 1103958253 12:124591793-124591815 CCCAGCCCATCCCTGACATTTCT No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958252_1103958264 11 Left 1103958252 12:124591788-124591810 CCGCACCCAGCCCATCCCTGACA No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958259_1103958264 -4 Left 1103958259 12:124591803-124591825 CCCTGACATTTCTGGGCCCTCAC No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958257_1103958264 1 Left 1103958257 12:124591798-124591820 CCCATCCCTGACATTTCTGGGCC No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data
1103958251_1103958264 14 Left 1103958251 12:124591785-124591807 CCACCGCACCCAGCCCATCCCTG No data
Right 1103958264 12:124591822-124591844 TCACTCTCTTCCAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103958264 Original CRISPR TCACTCTCTTCCAGGCACTT AGG Intergenic
No off target data available for this crispr