ID: 1103967440

View in Genome Browser
Species Human (GRCh38)
Location 12:124648871-124648893
Sequence TCTTTTCTTTGGAATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103967440_1103967444 -2 Left 1103967440 12:124648871-124648893 CCCTGCACATTCCAAAGAAAAGA No data
Right 1103967444 12:124648892-124648914 GAATGGACCTTGATCAGCTCTGG No data
1103967440_1103967446 19 Left 1103967440 12:124648871-124648893 CCCTGCACATTCCAAAGAAAAGA No data
Right 1103967446 12:124648913-124648935 GGACATAACCTTCACACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103967440 Original CRISPR TCTTTTCTTTGGAATGTGCA GGG (reversed) Intergenic
No off target data available for this crispr