ID: 1103967826

View in Genome Browser
Species Human (GRCh38)
Location 12:124651439-124651461
Sequence GAAGCTATTAAGTTTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103967826_1103967829 29 Left 1103967826 12:124651439-124651461 CCTGCTTAAAACTTAATAGCTTC No data
Right 1103967829 12:124651491-124651513 CATCCTCATGCTGCGTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103967826 Original CRISPR GAAGCTATTAAGTTTTAAGC AGG (reversed) Intergenic
No off target data available for this crispr