ID: 1103969917

View in Genome Browser
Species Human (GRCh38)
Location 12:124664062-124664084
Sequence CTCGCCTGGAAAAACACACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103969917_1103969932 30 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969932 12:124664115-124664137 TTCAGACAGGAGCCCTTTGAAGG No data
1103969917_1103969929 17 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969929 12:124664102-124664124 CCCGGGAGCCTGGTTCAGACAGG No data
1103969917_1103969923 -10 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969923 12:124664075-124664097 TCCAGGCGAGGATTGGGCTGGGG No data
1103969917_1103969925 -1 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969925 12:124664084-124664106 GGATTGGGCTGGGGTTTGCCCGG No data
1103969917_1103969926 0 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969926 12:124664085-124664107 GATTGGGCTGGGGTTTGCCCGGG No data
1103969917_1103969927 7 Left 1103969917 12:124664062-124664084 CCGAGTGTGTTTTTCCAGGCGAG No data
Right 1103969927 12:124664092-124664114 CTGGGGTTTGCCCGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103969917 Original CRISPR CTCGCCTGGAAAAACACACT CGG (reversed) Intergenic
No off target data available for this crispr